Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636941_at:

>probe:Drosophila_2:1636941_at:275:251; Interrogation_Position=12069; Antisense; CAAGCAAATCATGCAGGTGGTCTTT
>probe:Drosophila_2:1636941_at:510:647; Interrogation_Position=12077; Antisense; TCATGCAGGTGGTCTTTGGCGAAGC
>probe:Drosophila_2:1636941_at:145:573; Interrogation_Position=12093; Antisense; TGGCGAAGCGCTTTTTAGTTTTAAT
>probe:Drosophila_2:1636941_at:266:599; Interrogation_Position=12160; Antisense; TGTAATCATCGCGTAAGTGTAAAAT
>probe:Drosophila_2:1636941_at:154:1; Interrogation_Position=12183; Antisense; ATATTTTACTAAGCCGATTTTATGA
>probe:Drosophila_2:1636941_at:232:699; Interrogation_Position=12227; Antisense; TTTAGCGCTGTACAATACAAACAAG
>probe:Drosophila_2:1636941_at:664:389; Interrogation_Position=12292; Antisense; GACAATAGTTCGTAATTTTCGTAAT
>probe:Drosophila_2:1636941_at:241:727; Interrogation_Position=12367; Antisense; TTGGTTGGAAATACCTACTCGTAAT
>probe:Drosophila_2:1636941_at:208:491; Interrogation_Position=12387; Antisense; GTAATAATTTGTACTCTACACCTAG
>probe:Drosophila_2:1636941_at:702:155; Interrogation_Position=12404; Antisense; ACACCTAGATTCTTTGTAAGCGCGA
>probe:Drosophila_2:1636941_at:583:115; Interrogation_Position=12447; Antisense; AGCATAATGGTTTTAGTCGTAAGTA
>probe:Drosophila_2:1636941_at:5:491; Interrogation_Position=12465; Antisense; GTAAGTATACTTTGGTTCAACAGAT
>probe:Drosophila_2:1636941_at:335:157; Interrogation_Position=12525; Antisense; ACACAAGCATGCCTAAAGAAGTCGG
>probe:Drosophila_2:1636941_at:67:501; Interrogation_Position=12545; Antisense; GTCGGCAAACAAGCTTTGTCTGTAA

Paste this into a BLAST search page for me
CAAGCAAATCATGCAGGTGGTCTTTTCATGCAGGTGGTCTTTGGCGAAGCTGGCGAAGCGCTTTTTAGTTTTAATTGTAATCATCGCGTAAGTGTAAAATATATTTTACTAAGCCGATTTTATGATTTAGCGCTGTACAATACAAACAAGGACAATAGTTCGTAATTTTCGTAATTTGGTTGGAAATACCTACTCGTAATGTAATAATTTGTACTCTACACCTAGACACCTAGATTCTTTGTAAGCGCGAAGCATAATGGTTTTAGTCGTAAGTAGTAAGTATACTTTGGTTCAACAGATACACAAGCATGCCTAAAGAAGTCGGGTCGGCAAACAAGCTTTGTCTGTAA

Full Affymetrix probeset data:

Annotations for 1636941_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime