FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636942_at:

>probe:Drosophila_2:1636942_at:674:261; Interrogation_Position=102; Antisense; CAGCTTGTACAAACAGGCCACTGTG
>probe:Drosophila_2:1636942_at:526:463; Interrogation_Position=130; Antisense; GATTGCAATACAGATAAGCCCGGCT
>probe:Drosophila_2:1636942_at:662:453; Interrogation_Position=142; Antisense; GATAAGCCCGGCTTTCTGGACTTCA
>probe:Drosophila_2:1636942_at:40:71; Interrogation_Position=185; Antisense; AGGCGTGGAACAACCGCAAGGGAAT
>probe:Drosophila_2:1636942_at:369:563; Interrogation_Position=205; Antisense; GGAATGAGCAATACCGACGCCCAGG
>probe:Drosophila_2:1636942_at:379:723; Interrogation_Position=22; Antisense; TTGCAGGAATTCAACCAGGCGGCCG
>probe:Drosophila_2:1636942_at:467:65; Interrogation_Position=227; Antisense; AGGCCGCCTACATTACCAAGGTCAA
>probe:Drosophila_2:1636942_at:251:675; Interrogation_Position=240; Antisense; TACCAAGGTCAAGGCACTGATCGCT
>probe:Drosophila_2:1636942_at:292:355; Interrogation_Position=253; Antisense; GCACTGATCGCTGCCGTTGGCCTGA
>probe:Drosophila_2:1636942_at:655:307; Interrogation_Position=36; Antisense; CCAGGCGGCCGAAGATGTTAAGAAC
>probe:Drosophila_2:1636942_at:74:443; Interrogation_Position=49; Antisense; GATGTTAAGAACCTAAACACCACAC
>probe:Drosophila_2:1636942_at:436:527; Interrogation_Position=77; Antisense; GGGACAATGACCTTTTGGAGCTCTA
>probe:Drosophila_2:1636942_at:459:231; Interrogation_Position=82; Antisense; AATGACCTTTTGGAGCTCTACAGCT
>probe:Drosophila_2:1636942_at:318:729; Interrogation_Position=91; Antisense; TTGGAGCTCTACAGCTTGTACAAAC

Paste this into a BLAST search page for me
CAGCTTGTACAAACAGGCCACTGTGGATTGCAATACAGATAAGCCCGGCTGATAAGCCCGGCTTTCTGGACTTCAAGGCGTGGAACAACCGCAAGGGAATGGAATGAGCAATACCGACGCCCAGGTTGCAGGAATTCAACCAGGCGGCCGAGGCCGCCTACATTACCAAGGTCAATACCAAGGTCAAGGCACTGATCGCTGCACTGATCGCTGCCGTTGGCCTGACCAGGCGGCCGAAGATGTTAAGAACGATGTTAAGAACCTAAACACCACACGGGACAATGACCTTTTGGAGCTCTAAATGACCTTTTGGAGCTCTACAGCTTTGGAGCTCTACAGCTTGTACAAAC

Full Affymetrix probeset data:

Annotations for 1636942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720