FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636944_at:

>probe:Drosophila_2:1636944_at:75:439; Interrogation_Position=150; Antisense; GAGGACACCTATGATTCTCATCCGC
>probe:Drosophila_2:1636944_at:508:11; Interrogation_Position=163; Antisense; ATTCTCATCCGCAGTACTCATTTAA
>probe:Drosophila_2:1636944_at:684:11; Interrogation_Position=217; Antisense; ATGTTAAGTCCCAGTCGGAGTCTCG
>probe:Drosophila_2:1636944_at:111:573; Interrogation_Position=246; Antisense; GGCGATGTAGTCCACGGTCAGTACA
>probe:Drosophila_2:1636944_at:224:263; Interrogation_Position=269; Antisense; CAGCGTGAATGATGCCGATGGTTAC
>probe:Drosophila_2:1636944_at:31:59; Interrogation_Position=319; Antisense; ATGATGTCCGTGGATTCAACGCCGT
>probe:Drosophila_2:1636944_at:554:591; Interrogation_Position=343; Antisense; TGGTGCGTCGTGAACCACTTTCCAG
>probe:Drosophila_2:1636944_at:688:379; Interrogation_Position=383; Antisense; GAAGCCACAGGCTACAGCAGTCGTT
>probe:Drosophila_2:1636944_at:361:111; Interrogation_Position=398; Antisense; AGCAGTCGTTCCAAAAGTTCAGTTA
>probe:Drosophila_2:1636944_at:34:375; Interrogation_Position=431; Antisense; GAAGAAGTTGCCAGCCCTGAAGCCG
>probe:Drosophila_2:1636944_at:187:697; Interrogation_Position=457; Antisense; TTTCTCAGGCATCGGCTGTGGTGCA
>probe:Drosophila_2:1636944_at:567:469; Interrogation_Position=570; Antisense; GTTCCCGTGCTGAAGACTACCGTGC
>probe:Drosophila_2:1636944_at:82:47; Interrogation_Position=607; Antisense; ATCCCCATGCCATTTCATATGTGTT
>probe:Drosophila_2:1636944_at:229:659; Interrogation_Position=77; Antisense; TAAGACTGCGCTATTTGTGACCCTC

Paste this into a BLAST search page for me
GAGGACACCTATGATTCTCATCCGCATTCTCATCCGCAGTACTCATTTAAATGTTAAGTCCCAGTCGGAGTCTCGGGCGATGTAGTCCACGGTCAGTACACAGCGTGAATGATGCCGATGGTTACATGATGTCCGTGGATTCAACGCCGTTGGTGCGTCGTGAACCACTTTCCAGGAAGCCACAGGCTACAGCAGTCGTTAGCAGTCGTTCCAAAAGTTCAGTTAGAAGAAGTTGCCAGCCCTGAAGCCGTTTCTCAGGCATCGGCTGTGGTGCAGTTCCCGTGCTGAAGACTACCGTGCATCCCCATGCCATTTCATATGTGTTTAAGACTGCGCTATTTGTGACCCTC

Full Affymetrix probeset data:

Annotations for 1636944_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720