Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636945_at:

>probe:Drosophila_2:1636945_at:692:141; Interrogation_Position=1037; Antisense; ACTGTTCCGGCATCGTGGCTAATAA
>probe:Drosophila_2:1636945_at:520:519; Interrogation_Position=1051; Antisense; GTGGCTAATAATCATATACGCTTGT
>probe:Drosophila_2:1636945_at:325:431; Interrogation_Position=1089; Antisense; GAGTGCAGCCTTCGACTGACTGATC
>probe:Drosophila_2:1636945_at:628:143; Interrogation_Position=1103; Antisense; ACTGACTGATCCGTTTCATTTGACC
>probe:Drosophila_2:1636945_at:22:479; Interrogation_Position=1115; Antisense; GTTTCATTTGACCACCCATGAACTC
>probe:Drosophila_2:1636945_at:480:307; Interrogation_Position=1130; Antisense; CCATGAACTCAACGCCTTAAACTCA
>probe:Drosophila_2:1636945_at:592:309; Interrogation_Position=1143; Antisense; GCCTTAAACTCAAAACGTGCGCAAC
>probe:Drosophila_2:1636945_at:325:417; Interrogation_Position=1168; Antisense; GAGCACCCCAAGCATAGCAAACACT
>probe:Drosophila_2:1636945_at:35:157; Interrogation_Position=1226; Antisense; ACACACCTGTAACTTGTAATTTTCG
>probe:Drosophila_2:1636945_at:423:11; Interrogation_Position=1318; Antisense; ATTAGTTTCCGGCAAGTCCAAAGAG
>probe:Drosophila_2:1636945_at:351:527; Interrogation_Position=1345; Antisense; GGGAACACGTGAATTGATTTCTTTA
>probe:Drosophila_2:1636945_at:416:481; Interrogation_Position=1389; Antisense; GTATTTACTGATAACGGATGCTAAT
>probe:Drosophila_2:1636945_at:502:461; Interrogation_Position=1434; Antisense; GATTCACTTTGTTATTTTGTATTCC
>probe:Drosophila_2:1636945_at:512:659; Interrogation_Position=1556; Antisense; TAACCCAATTGTGTGATCCCGATCA

Paste this into a BLAST search page for me
ACTGTTCCGGCATCGTGGCTAATAAGTGGCTAATAATCATATACGCTTGTGAGTGCAGCCTTCGACTGACTGATCACTGACTGATCCGTTTCATTTGACCGTTTCATTTGACCACCCATGAACTCCCATGAACTCAACGCCTTAAACTCAGCCTTAAACTCAAAACGTGCGCAACGAGCACCCCAAGCATAGCAAACACTACACACCTGTAACTTGTAATTTTCGATTAGTTTCCGGCAAGTCCAAAGAGGGGAACACGTGAATTGATTTCTTTAGTATTTACTGATAACGGATGCTAATGATTCACTTTGTTATTTTGTATTCCTAACCCAATTGTGTGATCCCGATCA

Full Affymetrix probeset data:

Annotations for 1636945_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime