FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636946_at:

>probe:Drosophila_2:1636946_at:18:395; Interrogation_Position=1000; Antisense; GAAATGGTTCGAACGGGCATTGCCG
>probe:Drosophila_2:1636946_at:590:109; Interrogation_Position=1026; Antisense; AGAAGATCGAGTTGTCGCTGCCCAA
>probe:Drosophila_2:1636946_at:702:309; Interrogation_Position=1047; Antisense; CCAAGTTCCAGTTTGAGCAGCGCCT
>probe:Drosophila_2:1636946_at:136:413; Interrogation_Position=1078; Antisense; GACCCCTATCCTCAGCTTAATGGGA
>probe:Drosophila_2:1636946_at:438:229; Interrogation_Position=1111; Antisense; AATGTTCACGAGAAACGCCACCTTT
>probe:Drosophila_2:1636946_at:191:129; Interrogation_Position=1130; Antisense; ACCTTTGGAGACCTGACTGCCGATC
>probe:Drosophila_2:1636946_at:578:45; Interrogation_Position=1152; Antisense; ATCCCATTTCCCTTGTCATCGATGA
>probe:Drosophila_2:1636946_at:645:729; Interrogation_Position=1244; Antisense; TTGGTCAGCCGATCCAGCAGGCAGC
>probe:Drosophila_2:1636946_at:458:133; Interrogation_Position=1296; Antisense; ACCCGTTCGTGTTTCTTATCTATGA
>probe:Drosophila_2:1636946_at:410:539; Interrogation_Position=1327; Antisense; GGTAGACACGATTCTCTTTGCGGGC
>probe:Drosophila_2:1636946_at:96:499; Interrogation_Position=1352; Antisense; GTCTACAGCGATCCCAGGCAAATGC
>probe:Drosophila_2:1636946_at:50:605; Interrogation_Position=924; Antisense; TGATTATCATTCTGCCGAACTCCAA
>probe:Drosophila_2:1636946_at:145:709; Interrogation_Position=960; Antisense; TTAACCGTGTCATATCCCGGCTAAA
>probe:Drosophila_2:1636946_at:223:289; Interrogation_Position=977; Antisense; CGGCTAAATGCCGATTCCGTTAAGA

Paste this into a BLAST search page for me
GAAATGGTTCGAACGGGCATTGCCGAGAAGATCGAGTTGTCGCTGCCCAACCAAGTTCCAGTTTGAGCAGCGCCTGACCCCTATCCTCAGCTTAATGGGAAATGTTCACGAGAAACGCCACCTTTACCTTTGGAGACCTGACTGCCGATCATCCCATTTCCCTTGTCATCGATGATTGGTCAGCCGATCCAGCAGGCAGCACCCGTTCGTGTTTCTTATCTATGAGGTAGACACGATTCTCTTTGCGGGCGTCTACAGCGATCCCAGGCAAATGCTGATTATCATTCTGCCGAACTCCAATTAACCGTGTCATATCCCGGCTAAACGGCTAAATGCCGATTCCGTTAAGA

Full Affymetrix probeset data:

Annotations for 1636946_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720