Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636947_at:

>probe:Drosophila_2:1636947_at:454:21; Interrogation_Position=3269; Antisense; ATATGAAGCAACTGCCGCTGGGACC
>probe:Drosophila_2:1636947_at:721:411; Interrogation_Position=3290; Antisense; GACCGGTCAAGATTTGTTTCGCCTA
>probe:Drosophila_2:1636947_at:594:479; Interrogation_Position=3305; Antisense; GTTTCGCCTAGATGAAATGGTCTAA
>probe:Drosophila_2:1636947_at:364:369; Interrogation_Position=3352; Antisense; GAATGCGCCACAATTTTCATAGATT
>probe:Drosophila_2:1636947_at:216:627; Interrogation_Position=3377; Antisense; TAAGCCAATTAGCTTGGTTACCCCT
>probe:Drosophila_2:1636947_at:452:531; Interrogation_Position=3420; Antisense; GGGTCTTGCCAATTCGATGGATCAA
>probe:Drosophila_2:1636947_at:138:441; Interrogation_Position=3435; Antisense; GATGGATCAATGCTGCGAGCGATTT
>probe:Drosophila_2:1636947_at:22:337; Interrogation_Position=3446; Antisense; GCTGCGAGCGATTTGTTTTGCATTT
>probe:Drosophila_2:1636947_at:518:133; Interrogation_Position=3473; Antisense; ACGAACCTTTAATTGTATGCCTAAT
>probe:Drosophila_2:1636947_at:648:705; Interrogation_Position=3537; Antisense; TTACAACGTTTTCATGCCCTGCTTA
>probe:Drosophila_2:1636947_at:133:281; Interrogation_Position=3555; Antisense; CTGCTTACCTACCTATAACTGATCG
>probe:Drosophila_2:1636947_at:385:247; Interrogation_Position=3634; Antisense; AATTGAAGCCAGCTATCGGGCAGCC
>probe:Drosophila_2:1636947_at:153:681; Interrogation_Position=3647; Antisense; TATCGGGCAGCCCTATTTCCTTATA
>probe:Drosophila_2:1636947_at:278:321; Interrogation_Position=3656; Antisense; GCCCTATTTCCTTATACACAACTTA

Paste this into a BLAST search page for me
ATATGAAGCAACTGCCGCTGGGACCGACCGGTCAAGATTTGTTTCGCCTAGTTTCGCCTAGATGAAATGGTCTAAGAATGCGCCACAATTTTCATAGATTTAAGCCAATTAGCTTGGTTACCCCTGGGTCTTGCCAATTCGATGGATCAAGATGGATCAATGCTGCGAGCGATTTGCTGCGAGCGATTTGTTTTGCATTTACGAACCTTTAATTGTATGCCTAATTTACAACGTTTTCATGCCCTGCTTACTGCTTACCTACCTATAACTGATCGAATTGAAGCCAGCTATCGGGCAGCCTATCGGGCAGCCCTATTTCCTTATAGCCCTATTTCCTTATACACAACTTA

Full Affymetrix probeset data:

Annotations for 1636947_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime