FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636950_at:

>probe:Drosophila_2:1636950_at:288:67; Interrogation_Position=151; Antisense; ATGGCATCAATGTGGCGGCGGTAAT
>probe:Drosophila_2:1636950_at:184:515; Interrogation_Position=182; Antisense; GGGCGATACTATATCCCAGTTCTTT
>probe:Drosophila_2:1636950_at:394:585; Interrogation_Position=266; Antisense; TGGACTGGTGTTCGTTGGCCCAACT
>probe:Drosophila_2:1636950_at:367:621; Interrogation_Position=292; Antisense; TGCGCCGGTGGTACCATTTTTTGGA
>probe:Drosophila_2:1636950_at:339:183; Interrogation_Position=363; Antisense; AAAATGCTGGTCGACCAGACCCTTT
>probe:Drosophila_2:1636950_at:595:69; Interrogation_Position=405; Antisense; ATGGCCATGTCTTTTTTGGTGCCAC
>probe:Drosophila_2:1636950_at:60:569; Interrogation_Position=460; Antisense; GGCAGCGCATTCTTGATAGCTACCT
>probe:Drosophila_2:1636950_at:7:5; Interrogation_Position=491; Antisense; ATTGGTCCGCAACTATATGCTCTGG
>probe:Drosophila_2:1636950_at:483:581; Interrogation_Position=513; Antisense; TGGCCGGCCGCACAGATGCTAAACT
>probe:Drosophila_2:1636950_at:609:599; Interrogation_Position=529; Antisense; TGCTAAACTTCAGATTCGTGCCGCT
>probe:Drosophila_2:1636950_at:258:647; Interrogation_Position=580; Antisense; TCATCGCCCTCGTATGGAACTGCTA
>probe:Drosophila_2:1636950_at:566:283; Interrogation_Position=599; Antisense; CTGCTACCTCTCCATGATACTTAAT
>probe:Drosophila_2:1636950_at:423:525; Interrogation_Position=629; Antisense; GGGCACTAAGTTCCCCGCATAAGTA
>probe:Drosophila_2:1636950_at:484:139; Interrogation_Position=656; Antisense; ACGGTGCCTGTGTATCAAATTTAAC

Paste this into a BLAST search page for me
ATGGCATCAATGTGGCGGCGGTAATGGGCGATACTATATCCCAGTTCTTTTGGACTGGTGTTCGTTGGCCCAACTTGCGCCGGTGGTACCATTTTTTGGAAAAATGCTGGTCGACCAGACCCTTTATGGCCATGTCTTTTTTGGTGCCACGGCAGCGCATTCTTGATAGCTACCTATTGGTCCGCAACTATATGCTCTGGTGGCCGGCCGCACAGATGCTAAACTTGCTAAACTTCAGATTCGTGCCGCTTCATCGCCCTCGTATGGAACTGCTACTGCTACCTCTCCATGATACTTAATGGGCACTAAGTTCCCCGCATAAGTAACGGTGCCTGTGTATCAAATTTAAC

Full Affymetrix probeset data:

Annotations for 1636950_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720