Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636951_at:

>probe:Drosophila_2:1636951_at:25:81; Interrogation_Position=1012; Antisense; AGGGAATGTTGCCTACTCTACTCAA
>probe:Drosophila_2:1636951_at:645:667; Interrogation_Position=1025; Antisense; TACTCTACTCAAGGCAGGACTGATG
>probe:Drosophila_2:1636951_at:175:73; Interrogation_Position=1040; Antisense; AGGACTGATGAGTGCCGTGTACTTC
>probe:Drosophila_2:1636951_at:621:515; Interrogation_Position=1056; Antisense; GTGTACTTCTCCATCTATGACATGT
>probe:Drosophila_2:1636951_at:178:279; Interrogation_Position=1070; Antisense; CTATGACATGTTTAAGCGCCACTAT
>probe:Drosophila_2:1636951_at:71:323; Interrogation_Position=1085; Antisense; GCGCCACTATATAGCTCCGATGAAA
>probe:Drosophila_2:1636951_at:403:565; Interrogation_Position=672; Antisense; TGGATGGGACTTTCCCGAGGACTAC
>probe:Drosophila_2:1636951_at:563:671; Interrogation_Position=694; Antisense; TACCCTTCACGCTTGTGCAGGTGTT
>probe:Drosophila_2:1636951_at:557:525; Interrogation_Position=730; Antisense; GGGCAAACTTTCTCTTCTACAAGTA
>probe:Drosophila_2:1636951_at:383:653; Interrogation_Position=757; Antisense; TCAACGCGGCTGTCTTGATGGCCAA
>probe:Drosophila_2:1636951_at:530:141; Interrogation_Position=808; Antisense; ACGGCGCATTTCTGTTTCTCAATGG
>probe:Drosophila_2:1636951_at:315:215; Interrogation_Position=855; Antisense; AAGATGATCGTGTACCCGGCGGACC
>probe:Drosophila_2:1636951_at:663:307; Interrogation_Position=896; Antisense; CCAGCTGATGGCCTTCAAACAGGAA
>probe:Drosophila_2:1636951_at:216:33; Interrogation_Position=969; Antisense; ATCACCACCACGTTTCGGGAGGAAG

Paste this into a BLAST search page for me
AGGGAATGTTGCCTACTCTACTCAATACTCTACTCAAGGCAGGACTGATGAGGACTGATGAGTGCCGTGTACTTCGTGTACTTCTCCATCTATGACATGTCTATGACATGTTTAAGCGCCACTATGCGCCACTATATAGCTCCGATGAAATGGATGGGACTTTCCCGAGGACTACTACCCTTCACGCTTGTGCAGGTGTTGGGCAAACTTTCTCTTCTACAAGTATCAACGCGGCTGTCTTGATGGCCAAACGGCGCATTTCTGTTTCTCAATGGAAGATGATCGTGTACCCGGCGGACCCCAGCTGATGGCCTTCAAACAGGAAATCACCACCACGTTTCGGGAGGAAG

Full Affymetrix probeset data:

Annotations for 1636951_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime