Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636952_at:

>probe:Drosophila_2:1636952_at:73:343; Interrogation_Position=1002; Antisense; GCTTTCTCTGCTTCTTGGCAAAACA
>probe:Drosophila_2:1636952_at:130:77; Interrogation_Position=461; Antisense; AGGAGTACATGCACTTTCGCTATCG
>probe:Drosophila_2:1636952_at:701:339; Interrogation_Position=479; Antisense; GCTATCGCGGTCACTTGGAGGTCAG
>probe:Drosophila_2:1636952_at:162:195; Interrogation_Position=515; Antisense; AACTGCGAGTCCTGGCGTGGTCTAT
>probe:Drosophila_2:1636952_at:346:447; Interrogation_Position=552; Antisense; GATGCTGATCATTACGGCCGTTCTG
>probe:Drosophila_2:1636952_at:554:539; Interrogation_Position=579; Antisense; GGTATACTACCTCAAGCATTTCTTC
>probe:Drosophila_2:1636952_at:492:17; Interrogation_Position=596; Antisense; ATTTCTTCGAAGTCAAGCGCGTGGT
>probe:Drosophila_2:1636952_at:212:659; Interrogation_Position=758; Antisense; TAACGACTGGTCTTTCCTTGTGGCT
>probe:Drosophila_2:1636952_at:144:715; Interrogation_Position=784; Antisense; TTCTTTCCCCTCAATTTGTTGCATA
>probe:Drosophila_2:1636952_at:423:723; Interrogation_Position=802; Antisense; TTGCATATTTCACGCTTCACAAACC
>probe:Drosophila_2:1636952_at:98:713; Interrogation_Position=878; Antisense; TTCACCTATATAGACTGTGGCCCGC
>probe:Drosophila_2:1636952_at:485:595; Interrogation_Position=893; Antisense; TGTGGCCCGCATTGGATTAGCAGTA
>probe:Drosophila_2:1636952_at:490:55; Interrogation_Position=925; Antisense; ATGACGGGTGTCCACACATGGCCAA
>probe:Drosophila_2:1636952_at:314:579; Interrogation_Position=944; Antisense; GGCCAATACACCAGTCGAGTCGGAA

Paste this into a BLAST search page for me
GCTTTCTCTGCTTCTTGGCAAAACAAGGAGTACATGCACTTTCGCTATCGGCTATCGCGGTCACTTGGAGGTCAGAACTGCGAGTCCTGGCGTGGTCTATGATGCTGATCATTACGGCCGTTCTGGGTATACTACCTCAAGCATTTCTTCATTTCTTCGAAGTCAAGCGCGTGGTTAACGACTGGTCTTTCCTTGTGGCTTTCTTTCCCCTCAATTTGTTGCATATTGCATATTTCACGCTTCACAAACCTTCACCTATATAGACTGTGGCCCGCTGTGGCCCGCATTGGATTAGCAGTAATGACGGGTGTCCACACATGGCCAAGGCCAATACACCAGTCGAGTCGGAA

Full Affymetrix probeset data:

Annotations for 1636952_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime