FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636954_at:

>probe:Drosophila_2:1636954_at:121:351; Interrogation_Position=5837; Antisense; GCAGATGCTACCGTGCAAACTGTGA
>probe:Drosophila_2:1636954_at:87:427; Interrogation_Position=5893; Antisense; GAGAGTTTGCATTTCATCATGCTGT
>probe:Drosophila_2:1636954_at:591:119; Interrogation_Position=5957; Antisense; AGCTGTGGCTTAGTACTTAAATTTC
>probe:Drosophila_2:1636954_at:631:25; Interrogation_Position=6001; Antisense; ATAGGTCCCAATAATTTCAGATTTT
>probe:Drosophila_2:1636954_at:508:713; Interrogation_Position=6016; Antisense; TTCAGATTTTTCAAGCTGTCCAAAA
>probe:Drosophila_2:1636954_at:503:397; Interrogation_Position=6081; Antisense; GACAAAGGTTACATTTCACACCATT
>probe:Drosophila_2:1636954_at:284:651; Interrogation_Position=6096; Antisense; TCACACCATTTTTGATCTTGCAAGG
>probe:Drosophila_2:1636954_at:6:617; Interrogation_Position=6114; Antisense; TGCAAGGATTGATTCCTACTCCCAC
>probe:Drosophila_2:1636954_at:202:137; Interrogation_Position=6137; Antisense; ACTGCTTTGGATCAACCCCTTTCAC
>probe:Drosophila_2:1636954_at:154:395; Interrogation_Position=6253; Antisense; GAAATTCAATTGTGGCCTCGGTCTG
>probe:Drosophila_2:1636954_at:255:571; Interrogation_Position=6296; Antisense; GGCTTCATGCCTTCATGCATATTTA
>probe:Drosophila_2:1636954_at:350:327; Interrogation_Position=6332; Antisense; GCGTTAACTGAATTTTTCACCGGCA
>probe:Drosophila_2:1636954_at:481:701; Interrogation_Position=6345; Antisense; TTTTCACCGGCATTCTGCAGATGGA
>probe:Drosophila_2:1636954_at:578:49; Interrogation_Position=6395; Antisense; ATGCGTGGGCGTGCGGCCCTCAAAA

Paste this into a BLAST search page for me
GCAGATGCTACCGTGCAAACTGTGAGAGAGTTTGCATTTCATCATGCTGTAGCTGTGGCTTAGTACTTAAATTTCATAGGTCCCAATAATTTCAGATTTTTTCAGATTTTTCAAGCTGTCCAAAAGACAAAGGTTACATTTCACACCATTTCACACCATTTTTGATCTTGCAAGGTGCAAGGATTGATTCCTACTCCCACACTGCTTTGGATCAACCCCTTTCACGAAATTCAATTGTGGCCTCGGTCTGGGCTTCATGCCTTCATGCATATTTAGCGTTAACTGAATTTTTCACCGGCATTTTCACCGGCATTCTGCAGATGGAATGCGTGGGCGTGCGGCCCTCAAAA

Full Affymetrix probeset data:

Annotations for 1636954_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720