FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636956_at:

>probe:Drosophila_2:1636956_at:381:197; Interrogation_Position=101; Antisense; AACGGAAGACGCTGTGGAGCTGCAA
>probe:Drosophila_2:1636956_at:455:105; Interrogation_Position=128; Antisense; AGAAAAGGCGCTCGAATTCTTCCGA
>probe:Drosophila_2:1636956_at:409:243; Interrogation_Position=142; Antisense; AATTCTTCCGAGTCCTGACCTTTGT
>probe:Drosophila_2:1636956_at:128:611; Interrogation_Position=157; Antisense; TGACCTTTGTGCTACTCTTCCTGAT
>probe:Drosophila_2:1636956_at:409:453; Interrogation_Position=179; Antisense; GATCATCTCCCTGTATCTATATCGA
>probe:Drosophila_2:1636956_at:80:43; Interrogation_Position=199; Antisense; ATCGATTCGCATTCTAAAGGACTAG
>probe:Drosophila_2:1636956_at:255:225; Interrogation_Position=215; Antisense; AAGGACTAGCGCTGACTGCCTGGGA
>probe:Drosophila_2:1636956_at:140:405; Interrogation_Position=228; Antisense; GACTGCCTGGGATTTTTGGCCACAG
>probe:Drosophila_2:1636956_at:646:187; Interrogation_Position=450; Antisense; AACACGATCTTTGTCTCAGGGTCCG
>probe:Drosophila_2:1636956_at:201:525; Interrogation_Position=465; Antisense; TCAGGGTCCGTATAGAAAACCTCAT
>probe:Drosophila_2:1636956_at:477:173; Interrogation_Position=481; Antisense; AAACCTCATAGAAAGCCCAGACCTG
>probe:Drosophila_2:1636956_at:704:161; Interrogation_Position=529; Antisense; AAATTCCAGACACACAATGCCACAT
>probe:Drosophila_2:1636956_at:84:539; Interrogation_Position=54; Antisense; GGTAGCAGGCAGGATCAATAGGATT
>probe:Drosophila_2:1636956_at:482:543; Interrogation_Position=74; Antisense; GGATTTCATCGTGGCAACCTGAGGA

Paste this into a BLAST search page for me
AACGGAAGACGCTGTGGAGCTGCAAAGAAAAGGCGCTCGAATTCTTCCGAAATTCTTCCGAGTCCTGACCTTTGTTGACCTTTGTGCTACTCTTCCTGATGATCATCTCCCTGTATCTATATCGAATCGATTCGCATTCTAAAGGACTAGAAGGACTAGCGCTGACTGCCTGGGAGACTGCCTGGGATTTTTGGCCACAGAACACGATCTTTGTCTCAGGGTCCGTCAGGGTCCGTATAGAAAACCTCATAAACCTCATAGAAAGCCCAGACCTGAAATTCCAGACACACAATGCCACATGGTAGCAGGCAGGATCAATAGGATTGGATTTCATCGTGGCAACCTGAGGA

Full Affymetrix probeset data:

Annotations for 1636956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720