Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636957_s_at:

>probe:Drosophila_2:1636957_s_at:82:147; Interrogation_Position=117; Antisense; ACTACGTCTCGGAAACTGGGAATAT
>probe:Drosophila_2:1636957_s_at:503:593; Interrogation_Position=133; Antisense; TGGGAATATCTCTGTCAGCATCCAG
>probe:Drosophila_2:1636957_s_at:606:493; Interrogation_Position=146; Antisense; GTCAGCATCCAGAGATACGGGCCAT
>probe:Drosophila_2:1636957_s_at:333:291; Interrogation_Position=163; Antisense; CGGGCCATAATTCGTGTTATCCTTC
>probe:Drosophila_2:1636957_s_at:690:475; Interrogation_Position=178; Antisense; GTTATCCTTCATCAGGCACTCAATG
>probe:Drosophila_2:1636957_s_at:592:327; Interrogation_Position=238; Antisense; GCTGATTTGTTCAACTGCGCACAGA
>probe:Drosophila_2:1636957_s_at:118:111; Interrogation_Position=260; Antisense; AGAATCCGCTGCTAGTGCCTATGAT
>probe:Drosophila_2:1636957_s_at:400:363; Interrogation_Position=313; Antisense; GAATTGAAACGTGGCCGCTGGAGTC
>probe:Drosophila_2:1636957_s_at:397:333; Interrogation_Position=329; Antisense; GCTGGAGTCAGTTCGACGCCGAGAT
>probe:Drosophila_2:1636957_s_at:363:411; Interrogation_Position=343; Antisense; GACGCCGAGATGCTCTTCATGGAGA
>probe:Drosophila_2:1636957_s_at:660:711; Interrogation_Position=358; Antisense; TTCATGGAGAGTCCATCGACGCACT
>probe:Drosophila_2:1636957_s_at:138:75; Interrogation_Position=404; Antisense; AGGATAGCAATGTCCATCCGGTGCT
>probe:Drosophila_2:1636957_s_at:318:47; Interrogation_Position=419; Antisense; ATCCGGTGCTTACATATGCGCTGGT
>probe:Drosophila_2:1636957_s_at:503:623; Interrogation_Position=435; Antisense; TGCGCTGGTCTTCAAGAAACCCGAT

Paste this into a BLAST search page for me
ACTACGTCTCGGAAACTGGGAATATTGGGAATATCTCTGTCAGCATCCAGGTCAGCATCCAGAGATACGGGCCATCGGGCCATAATTCGTGTTATCCTTCGTTATCCTTCATCAGGCACTCAATGGCTGATTTGTTCAACTGCGCACAGAAGAATCCGCTGCTAGTGCCTATGATGAATTGAAACGTGGCCGCTGGAGTCGCTGGAGTCAGTTCGACGCCGAGATGACGCCGAGATGCTCTTCATGGAGATTCATGGAGAGTCCATCGACGCACTAGGATAGCAATGTCCATCCGGTGCTATCCGGTGCTTACATATGCGCTGGTTGCGCTGGTCTTCAAGAAACCCGAT

Full Affymetrix probeset data:

Annotations for 1636957_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime