Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636961_a_at:

>probe:Drosophila_2:1636961_a_at:4:447; Interrogation_Position=510; Antisense; GATGCATCAGCATGGGTGCTCACTA
>probe:Drosophila_2:1636961_a_at:473:535; Interrogation_Position=524; Antisense; GGTGCTCACTATAACCCCGATAAGG
>probe:Drosophila_2:1636961_a_at:181:31; Interrogation_Position=543; Antisense; ATAAGGTTGATCACGGTGGCCCCGA
>probe:Drosophila_2:1636961_a_at:65:137; Interrogation_Position=570; Antisense; ACGAGGTGCGTCATGTTGGCGATCT
>probe:Drosophila_2:1636961_a_at:320:191; Interrogation_Position=611; Antisense; AACTCCACGGGCATTATCGACGTTA
>probe:Drosophila_2:1636961_a_at:616:533; Interrogation_Position=649; Antisense; GGTGATCACCTTAACTGGCAAGCTG
>probe:Drosophila_2:1636961_a_at:496:77; Interrogation_Position=711; Antisense; AGGATGATCTCGGTCTGGGCAACCA
>probe:Drosophila_2:1636961_a_at:572:577; Interrogation_Position=767; Antisense; GGCCGCATTGCCTGTGGTGTTATTG
>probe:Drosophila_2:1636961_a_at:351:85; Interrogation_Position=798; Antisense; AGTAAATATCCCTTCCAACGTGTCA
>probe:Drosophila_2:1636961_a_at:705:675; Interrogation_Position=857; Antisense; TAGTTGTGTAACTCCAGGCGTAGTA
>probe:Drosophila_2:1636961_a_at:527:139; Interrogation_Position=931; Antisense; ACTCACCCTTACATGTTTGGCTTAC
>probe:Drosophila_2:1636961_a_at:28:693; Interrogation_Position=946; Antisense; TTTGGCTTACACATTTCCCTCAATT
>probe:Drosophila_2:1636961_a_at:84:649; Interrogation_Position=978; Antisense; TCAGTTCACTGACTCACTCGATTTG
>probe:Drosophila_2:1636961_a_at:563:145; Interrogation_Position=993; Antisense; ACTCGATTTGCCGTGTGTGTGTTTG

Paste this into a BLAST search page for me
GATGCATCAGCATGGGTGCTCACTAGGTGCTCACTATAACCCCGATAAGGATAAGGTTGATCACGGTGGCCCCGAACGAGGTGCGTCATGTTGGCGATCTAACTCCACGGGCATTATCGACGTTAGGTGATCACCTTAACTGGCAAGCTGAGGATGATCTCGGTCTGGGCAACCAGGCCGCATTGCCTGTGGTGTTATTGAGTAAATATCCCTTCCAACGTGTCATAGTTGTGTAACTCCAGGCGTAGTAACTCACCCTTACATGTTTGGCTTACTTTGGCTTACACATTTCCCTCAATTTCAGTTCACTGACTCACTCGATTTGACTCGATTTGCCGTGTGTGTGTTTG

Full Affymetrix probeset data:

Annotations for 1636961_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime