FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636962_at:

>probe:Drosophila_2:1636962_at:671:85; Interrogation_Position=375; Antisense; AGTGAATCCGAAAACCTGCCACATC
>probe:Drosophila_2:1636962_at:163:267; Interrogation_Position=421; Antisense; CAGTAGCGTTCTGTGCTGTTGGTGA
>probe:Drosophila_2:1636962_at:391:9; Interrogation_Position=512; Antisense; ATTCAAAGTGGGAGCAGCCTTCCGT
>probe:Drosophila_2:1636962_at:466:719; Interrogation_Position=531; Antisense; TTCCGTGCGAAGTGCGGCAGGATCT
>probe:Drosophila_2:1636962_at:149:39; Interrogation_Position=552; Antisense; ATCTACGCGGGCTGCAACATCGAGA
>probe:Drosophila_2:1636962_at:312:107; Interrogation_Position=574; Antisense; AGAACGTAGCTTTCACTCCAGGCAA
>probe:Drosophila_2:1636962_at:622:361; Interrogation_Position=595; Antisense; GCAATTGTGCGGAGCGTTGTGCCCT
>probe:Drosophila_2:1636962_at:34:507; Interrogation_Position=613; Antisense; GTGCCCTGGCCAAGGGTATCAGCGA
>probe:Drosophila_2:1636962_at:607:515; Interrogation_Position=666; Antisense; GTGGTAGCCTATCACCCAGATGGGT
>probe:Drosophila_2:1636962_at:51:99; Interrogation_Position=683; Antisense; AGATGGGTTTACCACACCTTGCGGA
>probe:Drosophila_2:1636962_at:465:281; Interrogation_Position=710; Antisense; CTGCCGGCAGTTCATTTTGGAGTTC
>probe:Drosophila_2:1636962_at:413:101; Interrogation_Position=785; Antisense; AGAGAACTGCATTCCTTCAATTCCG
>probe:Drosophila_2:1636962_at:543:207; Interrogation_Position=814; Antisense; AAGCTGAAGTGCTGGTCACGTCCGC
>probe:Drosophila_2:1636962_at:721:717; Interrogation_Position=850; Antisense; TTCCCCACAGCTTTAACTCATTTGA

Paste this into a BLAST search page for me
AGTGAATCCGAAAACCTGCCACATCCAGTAGCGTTCTGTGCTGTTGGTGAATTCAAAGTGGGAGCAGCCTTCCGTTTCCGTGCGAAGTGCGGCAGGATCTATCTACGCGGGCTGCAACATCGAGAAGAACGTAGCTTTCACTCCAGGCAAGCAATTGTGCGGAGCGTTGTGCCCTGTGCCCTGGCCAAGGGTATCAGCGAGTGGTAGCCTATCACCCAGATGGGTAGATGGGTTTACCACACCTTGCGGACTGCCGGCAGTTCATTTTGGAGTTCAGAGAACTGCATTCCTTCAATTCCGAAGCTGAAGTGCTGGTCACGTCCGCTTCCCCACAGCTTTAACTCATTTGA

Full Affymetrix probeset data:

Annotations for 1636962_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720