Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636963_at:

>probe:Drosophila_2:1636963_at:22:133; Interrogation_Position=122; Antisense; ACCGAGGTCTATAATGGCATTCCAT
>probe:Drosophila_2:1636963_at:144:549; Interrogation_Position=148; Antisense; GGAGATTGATACCACACCGTTCGTG
>probe:Drosophila_2:1636963_at:166:193; Interrogation_Position=185; Antisense; AACTATTACTACATCGAGCCCATGA
>probe:Drosophila_2:1636963_at:137:597; Interrogation_Position=242; Antisense; TGTCGCATGATGAACGCCCACTTGG
>probe:Drosophila_2:1636963_at:75:317; Interrogation_Position=266; Antisense; GCCTCCATCGAGGATAAGCCGGAAA
>probe:Drosophila_2:1636963_at:110:459; Interrogation_Position=349; Antisense; GATATCGGGCAATGACCTGGGCACC
>probe:Drosophila_2:1636963_at:60:83; Interrogation_Position=375; Antisense; AGGGCGCCTTCTATTGGATGTCCAA
>probe:Drosophila_2:1636963_at:356:383; Interrogation_Position=427; Antisense; GAACGGGCCCAAGCAAATGCCGGAT
>probe:Drosophila_2:1636963_at:619:621; Interrogation_Position=45; Antisense; TGCTGCTAATCCTGACGAGCGTCGG
>probe:Drosophila_2:1636963_at:583:565; Interrogation_Position=461; Antisense; GGCAACGAGAACTGCGTCCACATGT
>probe:Drosophila_2:1636963_at:494:153; Interrogation_Position=480; Antisense; ACATGTTCGCCACCCGGGAGATGAT
>probe:Drosophila_2:1636963_at:504:97; Interrogation_Position=528; Antisense; AGATGCTGTACGTCTGCGAGGCGAC
>probe:Drosophila_2:1636963_at:67:317; Interrogation_Position=83; Antisense; GCCTATCTGCCCGATGTGAACATAT
>probe:Drosophila_2:1636963_at:238:613; Interrogation_Position=99; Antisense; TGAACATATTCACCAACTACCGCAC

Paste this into a BLAST search page for me
ACCGAGGTCTATAATGGCATTCCATGGAGATTGATACCACACCGTTCGTGAACTATTACTACATCGAGCCCATGATGTCGCATGATGAACGCCCACTTGGGCCTCCATCGAGGATAAGCCGGAAAGATATCGGGCAATGACCTGGGCACCAGGGCGCCTTCTATTGGATGTCCAAGAACGGGCCCAAGCAAATGCCGGATTGCTGCTAATCCTGACGAGCGTCGGGGCAACGAGAACTGCGTCCACATGTACATGTTCGCCACCCGGGAGATGATAGATGCTGTACGTCTGCGAGGCGACGCCTATCTGCCCGATGTGAACATATTGAACATATTCACCAACTACCGCAC

Full Affymetrix probeset data:

Annotations for 1636963_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime