Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636968_at:

>probe:Drosophila_2:1636968_at:384:669; Interrogation_Position=1098; Antisense; TACGACTTTGATGCTTATTCCCGGC
>probe:Drosophila_2:1636968_at:646:633; Interrogation_Position=1116; Antisense; TCCCGGCACGTTTGCATCGGAGGAA
>probe:Drosophila_2:1636968_at:179:371; Interrogation_Position=1181; Antisense; GAAGTTGTGGACTCCTCTTAGTTCT
>probe:Drosophila_2:1636968_at:308:459; Interrogation_Position=1239; Antisense; GATATAATGGTGTCCCTAGCCTATT
>probe:Drosophila_2:1636968_at:267:689; Interrogation_Position=1260; Antisense; TATTTGCCATCAGCGGAGCGTTTGA
>probe:Drosophila_2:1636968_at:504:415; Interrogation_Position=1275; Antisense; GAGCGTTTGATGGTCGTCCTTATCA
>probe:Drosophila_2:1636968_at:647:175; Interrogation_Position=1307; Antisense; AAACCTGCGGATTGTCGACGATGCC
>probe:Drosophila_2:1636968_at:12:385; Interrogation_Position=1334; Antisense; GAACTCCTCGGACCCTTATGTAAAG
>probe:Drosophila_2:1636968_at:149:317; Interrogation_Position=1366; Antisense; TCCTCGGTCCCGGTGGCAAAAAGAT
>probe:Drosophila_2:1636968_at:347:381; Interrogation_Position=1427; Antisense; GAACCCAGTCTATAATGAGGCTCTT
>probe:Drosophila_2:1636968_at:611:71; Interrogation_Position=1444; Antisense; AGGCTCTTGCTTTCGATGTGGCCAA
>probe:Drosophila_2:1636968_at:292:505; Interrogation_Position=1506; Antisense; GTCCACGATGGCCTATTGGGATCAA
>probe:Drosophila_2:1636968_at:39:385; Interrogation_Position=1546; Antisense; GAACTCTCATTGGAAACTCTCCGGA
>probe:Drosophila_2:1636968_at:377:231; Interrogation_Position=1620; Antisense; AATGCTACGGCTCAATGGGTTCCAC

Paste this into a BLAST search page for me
TACGACTTTGATGCTTATTCCCGGCTCCCGGCACGTTTGCATCGGAGGAAGAAGTTGTGGACTCCTCTTAGTTCTGATATAATGGTGTCCCTAGCCTATTTATTTGCCATCAGCGGAGCGTTTGAGAGCGTTTGATGGTCGTCCTTATCAAAACCTGCGGATTGTCGACGATGCCGAACTCCTCGGACCCTTATGTAAAGTCCTCGGTCCCGGTGGCAAAAAGATGAACCCAGTCTATAATGAGGCTCTTAGGCTCTTGCTTTCGATGTGGCCAAGTCCACGATGGCCTATTGGGATCAAGAACTCTCATTGGAAACTCTCCGGAAATGCTACGGCTCAATGGGTTCCAC

Full Affymetrix probeset data:

Annotations for 1636968_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime