Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636970_at:

>probe:Drosophila_2:1636970_at:606:201; Interrogation_Position=1731; Antisense; AACCTGTTCGCGGATCGCATTCTGG
>probe:Drosophila_2:1636970_at:659:273; Interrogation_Position=1748; Antisense; CATTCTGGCTGTGGTGCGACGACAT
>probe:Drosophila_2:1636970_at:465:573; Interrogation_Position=1773; Antisense; GGCTGCGGTCGACTCAATGTGATCA
>probe:Drosophila_2:1636970_at:260:343; Interrogation_Position=1831; Antisense; GCTTCAAGCAGCACATGTACCCGGT
>probe:Drosophila_2:1636970_at:195:73; Interrogation_Position=1876; Antisense; AGGAGAACGTCTTCAACGATCCCCG
>probe:Drosophila_2:1636970_at:189:551; Interrogation_Position=1913; Antisense; GGAGCAGAGCGTCAACTTTGCCCAG
>probe:Drosophila_2:1636970_at:238:199; Interrogation_Position=1965; Antisense; AACGCCGTGTTCGTCAAGGCGGATC
>probe:Drosophila_2:1636970_at:311:169; Interrogation_Position=2009; Antisense; AAAGGCACAGGTGCCCATTGTCCTG
>probe:Drosophila_2:1636970_at:613:279; Interrogation_Position=2049; Antisense; CTCAAGGATCGGGAGTCCATCGACT
>probe:Drosophila_2:1636970_at:255:271; Interrogation_Position=2066; Antisense; CATCGACTGGTTCCTGCAGCAGGGA
>probe:Drosophila_2:1636970_at:126:527; Interrogation_Position=2087; Antisense; GGGACCCACTGGAGTCATCTACGAT
>probe:Drosophila_2:1636970_at:211:525; Interrogation_Position=2174; Antisense; GGGCTACTTCCAGCTACAGTGCGAT
>probe:Drosophila_2:1636970_at:365:75; Interrogation_Position=2209; Antisense; AGGAGCGCGAGGTGAACTCCACCAT
>probe:Drosophila_2:1636970_at:271:485; Interrogation_Position=2264; Antisense; GTAGTGAATTCTGTAGAGCCACCAG

Paste this into a BLAST search page for me
AACCTGTTCGCGGATCGCATTCTGGCATTCTGGCTGTGGTGCGACGACATGGCTGCGGTCGACTCAATGTGATCAGCTTCAAGCAGCACATGTACCCGGTAGGAGAACGTCTTCAACGATCCCCGGGAGCAGAGCGTCAACTTTGCCCAGAACGCCGTGTTCGTCAAGGCGGATCAAAGGCACAGGTGCCCATTGTCCTGCTCAAGGATCGGGAGTCCATCGACTCATCGACTGGTTCCTGCAGCAGGGAGGGACCCACTGGAGTCATCTACGATGGGCTACTTCCAGCTACAGTGCGATAGGAGCGCGAGGTGAACTCCACCATGTAGTGAATTCTGTAGAGCCACCAG

Full Affymetrix probeset data:

Annotations for 1636970_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime