FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636971_at:

>probe:Drosophila_2:1636971_at:51:323; Interrogation_Position=118; Antisense; GCCCAACGTTTTGGCGCTTGAAGAT
>probe:Drosophila_2:1636971_at:137:375; Interrogation_Position=137; Antisense; GAAGATCGCTTATGGTTACTCAAAG
>probe:Drosophila_2:1636971_at:329:443; Interrogation_Position=162; Antisense; GATGTCAATACCCTCAAGCGTTTGG
>probe:Drosophila_2:1636971_at:353:727; Interrogation_Position=183; Antisense; TTGGGCGCCAGTCCGCGAAATGTAC
>probe:Drosophila_2:1636971_at:357:167; Interrogation_Position=200; Antisense; AAATGTACGCGATCACCCCGAAGGA
>probe:Drosophila_2:1636971_at:10:539; Interrogation_Position=222; Antisense; GGATGTACGCCCCAAACTTTGAACA
>probe:Drosophila_2:1636971_at:93:149; Interrogation_Position=237; Antisense; ACTTTGAACACAACTGCCTTCACTA
>probe:Drosophila_2:1636971_at:659:133; Interrogation_Position=277; Antisense; ACCCATCCACCTATCGGATTGTGGA
>probe:Drosophila_2:1636971_at:543:261; Interrogation_Position=365; Antisense; CAGCTATTATCGCTACTCGTACTAC
>probe:Drosophila_2:1636971_at:8:411; Interrogation_Position=450; Antisense; GACGCACCAAATTAGAAGCACTGAA
>probe:Drosophila_2:1636971_at:269:243; Interrogation_Position=495; Antisense; AATATTTATTTTCCATAGCTGTCGA
>probe:Drosophila_2:1636971_at:327:601; Interrogation_Position=63; Antisense; TGTATGAAATACAGCCCCACCATGC
>probe:Drosophila_2:1636971_at:708:259; Interrogation_Position=80; Antisense; CACCATGCGTGCTCCTTTAAGAATT
>probe:Drosophila_2:1636971_at:222:211; Interrogation_Position=98; Antisense; AAGAATTCCGCTTTTATGGCGCCCA

Paste this into a BLAST search page for me
GCCCAACGTTTTGGCGCTTGAAGATGAAGATCGCTTATGGTTACTCAAAGGATGTCAATACCCTCAAGCGTTTGGTTGGGCGCCAGTCCGCGAAATGTACAAATGTACGCGATCACCCCGAAGGAGGATGTACGCCCCAAACTTTGAACAACTTTGAACACAACTGCCTTCACTAACCCATCCACCTATCGGATTGTGGACAGCTATTATCGCTACTCGTACTACGACGCACCAAATTAGAAGCACTGAAAATATTTATTTTCCATAGCTGTCGATGTATGAAATACAGCCCCACCATGCCACCATGCGTGCTCCTTTAAGAATTAAGAATTCCGCTTTTATGGCGCCCA

Full Affymetrix probeset data:

Annotations for 1636971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720