FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636972_at:

>probe:Drosophila_2:1636972_at:567:165; Interrogation_Position=1004; Antisense; AAATCGCAACGCAATTTGGCGCCAA
>probe:Drosophila_2:1636972_at:49:407; Interrogation_Position=1047; Antisense; GACTGTCCTGCGAAATGCCATCAAT
>probe:Drosophila_2:1636972_at:336:461; Interrogation_Position=1083; Antisense; GATTACGGACGAGGGCAACTACTGC
>probe:Drosophila_2:1636972_at:183:87; Interrogation_Position=1139; Antisense; AGTGCTCCAAGTGCAAGGCGGTGCA
>probe:Drosophila_2:1636972_at:671:689; Interrogation_Position=1165; Antisense; TATTGCGATCGCGAATGCCAGCGGC
>probe:Drosophila_2:1636972_at:387:121; Interrogation_Position=1184; Antisense; AGCGGCTGCATTGGTTCATGCACAA
>probe:Drosophila_2:1636972_at:271:419; Interrogation_Position=1297; Antisense; GAGCTGCGCGAGGAACTGTCCAAAC
>probe:Drosophila_2:1636972_at:89:179; Interrogation_Position=1318; Antisense; AAACTGACTGCGTAATCCTGTGCTC
>probe:Drosophila_2:1636972_at:168:283; Interrogation_Position=1335; Antisense; CTGTGCTCCTTTGTAACGCCAATAA
>probe:Drosophila_2:1636972_at:466:15; Interrogation_Position=787; Antisense; ATTTTGGCCGAACTAATACGCTGCG
>probe:Drosophila_2:1636972_at:72:77; Interrogation_Position=812; Antisense; AGGAGCAATTCAAGGCGCAGCACAA
>probe:Drosophila_2:1636972_at:614:157; Interrogation_Position=947; Antisense; ACACGTTGCGCGAATGTGCCAGGGA
>probe:Drosophila_2:1636972_at:271:427; Interrogation_Position=970; Antisense; GAGTTTCCCGTGAGAGAGTGCACCA
>probe:Drosophila_2:1636972_at:99:427; Interrogation_Position=983; Antisense; GAGAGTGCACCATCTTCCGGCAAAT

Paste this into a BLAST search page for me
AAATCGCAACGCAATTTGGCGCCAAGACTGTCCTGCGAAATGCCATCAATGATTACGGACGAGGGCAACTACTGCAGTGCTCCAAGTGCAAGGCGGTGCATATTGCGATCGCGAATGCCAGCGGCAGCGGCTGCATTGGTTCATGCACAAGAGCTGCGCGAGGAACTGTCCAAACAAACTGACTGCGTAATCCTGTGCTCCTGTGCTCCTTTGTAACGCCAATAAATTTTGGCCGAACTAATACGCTGCGAGGAGCAATTCAAGGCGCAGCACAAACACGTTGCGCGAATGTGCCAGGGAGAGTTTCCCGTGAGAGAGTGCACCAGAGAGTGCACCATCTTCCGGCAAAT

Full Affymetrix probeset data:

Annotations for 1636972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720