Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636973_at:

>probe:Drosophila_2:1636973_at:708:601; Interrogation_Position=1024; Antisense; TGTATACTGAACTAATGCAGTTGGT
>probe:Drosophila_2:1636973_at:266:147; Interrogation_Position=1034; Antisense; ACTAATGCAGTTGGTTTTTCTCTTA
>probe:Drosophila_2:1636973_at:142:53; Interrogation_Position=1038; Antisense; ATGCAGTTGGTTTTTCTCTTATTTT
>probe:Drosophila_2:1636973_at:599:711; Interrogation_Position=1051; Antisense; TTCTCTTATTTTTGGCATTTACTAG
>probe:Drosophila_2:1636973_at:681:569; Interrogation_Position=1064; Antisense; GGCATTTACTAGTTTCCAAATATCT
>probe:Drosophila_2:1636973_at:423:17; Interrogation_Position=1083; Antisense; ATATCTAAAAATGTGCCGAAGCTCT
>probe:Drosophila_2:1636973_at:208:181; Interrogation_Position=1089; Antisense; AAAAATGTGCCGAAGCTCTGTGAAG
>probe:Drosophila_2:1636973_at:641:167; Interrogation_Position=1091; Antisense; AAATGTGCCGAAGCTCTGTGAAGGG
>probe:Drosophila_2:1636973_at:466:303; Interrogation_Position=1098; Antisense; CCGAAGCTCTGTGAAGGGCATATCT
>probe:Drosophila_2:1636973_at:703:205; Interrogation_Position=1101; Antisense; AAGCTCTGTGAAGGGCATATCTTTA
>probe:Drosophila_2:1636973_at:118:465; Interrogation_Position=1133; Antisense; GATTGCAATCAAATCATTTAGGAAC
>probe:Drosophila_2:1636973_at:440:273; Interrogation_Position=1147; Antisense; CATTTAGGAACATCACATTTCATGA
>probe:Drosophila_2:1636973_at:279:561; Interrogation_Position=1153; Antisense; GGAACATCACATTTCATGATGCATT
>probe:Drosophila_2:1636973_at:522:603; Interrogation_Position=1169; Antisense; TGATGCATTTTGATGATAAGATTCA

Paste this into a BLAST search page for me
TGTATACTGAACTAATGCAGTTGGTACTAATGCAGTTGGTTTTTCTCTTAATGCAGTTGGTTTTTCTCTTATTTTTTCTCTTATTTTTGGCATTTACTAGGGCATTTACTAGTTTCCAAATATCTATATCTAAAAATGTGCCGAAGCTCTAAAAATGTGCCGAAGCTCTGTGAAGAAATGTGCCGAAGCTCTGTGAAGGGCCGAAGCTCTGTGAAGGGCATATCTAAGCTCTGTGAAGGGCATATCTTTAGATTGCAATCAAATCATTTAGGAACCATTTAGGAACATCACATTTCATGAGGAACATCACATTTCATGATGCATTTGATGCATTTTGATGATAAGATTCA

Full Affymetrix probeset data:

Annotations for 1636973_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime