Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636974_at:

>probe:Drosophila_2:1636974_at:728:59; Interrogation_Position=3259; Antisense; ATGTCGCGGAGTGAATGCTTTTACC
>probe:Drosophila_2:1636974_at:554:49; Interrogation_Position=3273; Antisense; ATGCTTTTACCGAGTGTGAGTGCGA
>probe:Drosophila_2:1636974_at:664:417; Interrogation_Position=3296; Antisense; GAGCGGAGTGCCTGTTCAATGTGAT
>probe:Drosophila_2:1636974_at:483:147; Interrogation_Position=3337; Antisense; ACTATAAACACTTTAGCCCCTAGAG
>probe:Drosophila_2:1636974_at:530:669; Interrogation_Position=3350; Antisense; TAGCCCCTAGAGACCTAAGCGAAAA
>probe:Drosophila_2:1636974_at:558:657; Interrogation_Position=3365; Antisense; TAAGCGAAAAACACACCTACACCTA
>probe:Drosophila_2:1636974_at:185:601; Interrogation_Position=3428; Antisense; TGTAATGTAACCAGCAAATTGCCAC
>probe:Drosophila_2:1636974_at:173:627; Interrogation_Position=3447; Antisense; TGCCACAGCACACAATTTCAATTAT
>probe:Drosophila_2:1636974_at:551:497; Interrogation_Position=3535; Antisense; GTCTTATTTACGTTAACATGGCCAT
>probe:Drosophila_2:1636974_at:407:25; Interrogation_Position=3558; Antisense; ATAGAAAAGCGTCCGAGCCACGGCT
>probe:Drosophila_2:1636974_at:476:415; Interrogation_Position=3572; Antisense; GAGCCACGGCTTTTGTAATTTTGTA
>probe:Drosophila_2:1636974_at:573:725; Interrogation_Position=3592; Antisense; TTGTATCTTTCGTAGACAGCCCTGA
>probe:Drosophila_2:1636974_at:82:485; Interrogation_Position=3603; Antisense; GTAGACAGCCCTGACTTTTGCCAGC
>probe:Drosophila_2:1636974_at:324:309; Interrogation_Position=3623; Antisense; CCAGCCATCAAACGCATTTCAAACT

Paste this into a BLAST search page for me
ATGTCGCGGAGTGAATGCTTTTACCATGCTTTTACCGAGTGTGAGTGCGAGAGCGGAGTGCCTGTTCAATGTGATACTATAAACACTTTAGCCCCTAGAGTAGCCCCTAGAGACCTAAGCGAAAATAAGCGAAAAACACACCTACACCTATGTAATGTAACCAGCAAATTGCCACTGCCACAGCACACAATTTCAATTATGTCTTATTTACGTTAACATGGCCATATAGAAAAGCGTCCGAGCCACGGCTGAGCCACGGCTTTTGTAATTTTGTATTGTATCTTTCGTAGACAGCCCTGAGTAGACAGCCCTGACTTTTGCCAGCCCAGCCATCAAACGCATTTCAAACT

Full Affymetrix probeset data:

Annotations for 1636974_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime