FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636976_at:

>probe:Drosophila_2:1636976_at:485:503; Interrogation_Position=2270; Antisense; GTCGCCTTCTGAACGATGATGCGTT
>probe:Drosophila_2:1636976_at:360:459; Interrogation_Position=2355; Antisense; GATATACCTAATCCTCGATGCTGTT
>probe:Drosophila_2:1636976_at:423:465; Interrogation_Position=2399; Antisense; GATTGCTGCAACACCAGTTGGACCA
>probe:Drosophila_2:1636976_at:646:459; Interrogation_Position=2415; Antisense; GTTGGACCAACACTTCTGGAAGTTC
>probe:Drosophila_2:1636976_at:349:473; Interrogation_Position=2436; Antisense; GTTCTTTAGCAAGTCCAATGGCGTC
>probe:Drosophila_2:1636976_at:393:67; Interrogation_Position=2453; Antisense; ATGGCGTCGCCTCTGTAAACAGGAA
>probe:Drosophila_2:1636976_at:54:153; Interrogation_Position=2477; Antisense; ACATGATTCCCGATTTCTTCGGTAT
>probe:Drosophila_2:1636976_at:65:637; Interrogation_Position=2495; Antisense; TCGGTATTCCCGAATCCGTTGAATT
>probe:Drosophila_2:1636976_at:351:615; Interrogation_Position=2514; Antisense; TGAATTGCTTTCCTTGGAACCCTAC
>probe:Drosophila_2:1636976_at:331:475; Interrogation_Position=2593; Antisense; GTTAGCTTCAACATTTACCCACTTT
>probe:Drosophila_2:1636976_at:216:669; Interrogation_Position=2608; Antisense; TACCCACTTTTTGAGTCCCTAGATG
>probe:Drosophila_2:1636976_at:702:629; Interrogation_Position=2724; Antisense; TCCTTCCTCCGTTGAATATTACCAT
>probe:Drosophila_2:1636976_at:8:247; Interrogation_Position=2773; Antisense; AATTCAACGATGAACGCCTCCGGAT
>probe:Drosophila_2:1636976_at:398:471; Interrogation_Position=2812; Antisense; GTTCCCATGCAGATTCGCACATTTA

Paste this into a BLAST search page for me
GTCGCCTTCTGAACGATGATGCGTTGATATACCTAATCCTCGATGCTGTTGATTGCTGCAACACCAGTTGGACCAGTTGGACCAACACTTCTGGAAGTTCGTTCTTTAGCAAGTCCAATGGCGTCATGGCGTCGCCTCTGTAAACAGGAAACATGATTCCCGATTTCTTCGGTATTCGGTATTCCCGAATCCGTTGAATTTGAATTGCTTTCCTTGGAACCCTACGTTAGCTTCAACATTTACCCACTTTTACCCACTTTTTGAGTCCCTAGATGTCCTTCCTCCGTTGAATATTACCATAATTCAACGATGAACGCCTCCGGATGTTCCCATGCAGATTCGCACATTTA

Full Affymetrix probeset data:

Annotations for 1636976_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720