FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636977_at:

>probe:Drosophila_2:1636977_at:286:75; Interrogation_Position=1998; Antisense; AGGACTATCACTGGTGGTGGCGCTC
>probe:Drosophila_2:1636977_at:414:571; Interrogation_Position=2036; Antisense; GGCTTCACAGCAGTCTATCTGTTCA
>probe:Drosophila_2:1636977_at:55:41; Interrogation_Position=2052; Antisense; ATCTGTTCATATACTGCTGCCACTA
>probe:Drosophila_2:1636977_at:622:625; Interrogation_Position=2069; Antisense; TGCCACTACTTCGTCACAAAGCTTT
>probe:Drosophila_2:1636977_at:104:455; Interrogation_Position=2095; Antisense; GATCAAGGACAGTGCCTCGACGTTC
>probe:Drosophila_2:1636977_at:70:633; Interrogation_Position=2111; Antisense; TCGACGTTCCTGTATTTCGGCTACA
>probe:Drosophila_2:1636977_at:272:19; Interrogation_Position=2124; Antisense; ATTTCGGCTACACGGCCATTATGGT
>probe:Drosophila_2:1636977_at:673:65; Interrogation_Position=2144; Antisense; ATGGTATTCCTGTTCTTCTTGCTGA
>probe:Drosophila_2:1636977_at:379:719; Interrogation_Position=2186; Antisense; TTCGCGTGCTTTTGGTTCATACGTA
>probe:Drosophila_2:1636977_at:686:417; Interrogation_Position=2258; Antisense; GAGCTCGTGCGAATGTATTTTTGTA
>probe:Drosophila_2:1636977_at:594:229; Interrogation_Position=2312; Antisense; AATGTGTGTGTGATTTCTGCGCTGT
>probe:Drosophila_2:1636977_at:236:483; Interrogation_Position=2501; Antisense; GTATAGCTCTTCGTTCTGTTAATCT
>probe:Drosophila_2:1636977_at:298:245; Interrogation_Position=2536; Antisense; AATTTAGCATTGTCCATTTCCCAGC
>probe:Drosophila_2:1636977_at:595:307; Interrogation_Position=2556; Antisense; CCAGCTCTAGCAACGATTCCAAGAA

Paste this into a BLAST search page for me
AGGACTATCACTGGTGGTGGCGCTCGGCTTCACAGCAGTCTATCTGTTCAATCTGTTCATATACTGCTGCCACTATGCCACTACTTCGTCACAAAGCTTTGATCAAGGACAGTGCCTCGACGTTCTCGACGTTCCTGTATTTCGGCTACAATTTCGGCTACACGGCCATTATGGTATGGTATTCCTGTTCTTCTTGCTGATTCGCGTGCTTTTGGTTCATACGTAGAGCTCGTGCGAATGTATTTTTGTAAATGTGTGTGTGATTTCTGCGCTGTGTATAGCTCTTCGTTCTGTTAATCTAATTTAGCATTGTCCATTTCCCAGCCCAGCTCTAGCAACGATTCCAAGAA

Full Affymetrix probeset data:

Annotations for 1636977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720