Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636978_at:

>probe:Drosophila_2:1636978_at:678:223; Interrogation_Position=1030; Antisense; AATGGTGGCCCCTCTACGTCGATTC
>probe:Drosophila_2:1636978_at:459:527; Interrogation_Position=1084; Antisense; GGGATCTCGCCCACGGGTAGCAATA
>probe:Drosophila_2:1636978_at:681:351; Interrogation_Position=1109; Antisense; GCAGCAGTGGCATGGCTAACTCGAT
>probe:Drosophila_2:1636978_at:491:67; Interrogation_Position=1120; Antisense; ATGGCTAACTCGATTGTCGTCTCCG
>probe:Drosophila_2:1636978_at:562:353; Interrogation_Position=1144; Antisense; GCAGCCATGTCGAAGGCCCAGGAAG
>probe:Drosophila_2:1636978_at:635:577; Interrogation_Position=1158; Antisense; GGCCCAGGAAGTGAGTTCTTATCAT
>probe:Drosophila_2:1636978_at:234:509; Interrogation_Position=1220; Antisense; GTGACGGAAACGACTTCCACTGATT
>probe:Drosophila_2:1636978_at:634:557; Interrogation_Position=1249; Antisense; GGAAATGACAAGCACAACGGACTGA
>probe:Drosophila_2:1636978_at:263:281; Interrogation_Position=1355; Antisense; CTGACCCAATTTCGACTGCATTTTA
>probe:Drosophila_2:1636978_at:241:179; Interrogation_Position=1401; Antisense; AACAGAATTCCATTTTTCCAAACTG
>probe:Drosophila_2:1636978_at:689:625; Interrogation_Position=1417; Antisense; TCCAAACTGGACACTTTTATACATT
>probe:Drosophila_2:1636978_at:488:703; Interrogation_Position=1433; Antisense; TTATACATTTACTCTGCGCAGATCG
>probe:Drosophila_2:1636978_at:467:7; Interrogation_Position=1461; Antisense; ATTGCGACAGCGGAAGTTACGTTTA
>probe:Drosophila_2:1636978_at:161:479; Interrogation_Position=1481; Antisense; GTTTAGACGACCACAGCGTACGAGA

Paste this into a BLAST search page for me
AATGGTGGCCCCTCTACGTCGATTCGGGATCTCGCCCACGGGTAGCAATAGCAGCAGTGGCATGGCTAACTCGATATGGCTAACTCGATTGTCGTCTCCGGCAGCCATGTCGAAGGCCCAGGAAGGGCCCAGGAAGTGAGTTCTTATCATGTGACGGAAACGACTTCCACTGATTGGAAATGACAAGCACAACGGACTGACTGACCCAATTTCGACTGCATTTTAAACAGAATTCCATTTTTCCAAACTGTCCAAACTGGACACTTTTATACATTTTATACATTTACTCTGCGCAGATCGATTGCGACAGCGGAAGTTACGTTTAGTTTAGACGACCACAGCGTACGAGA

Full Affymetrix probeset data:

Annotations for 1636978_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime