Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636980_s_at:

>probe:Drosophila_2:1636980_s_at:194:345; Interrogation_Position=1016; Antisense; GCAGAGGGCCTACAACTTGGTTAAC
>probe:Drosophila_2:1636980_s_at:92:541; Interrogation_Position=1034; Antisense; GGTTAACAACTTCCACGGATCCATT
>probe:Drosophila_2:1636980_s_at:179:59; Interrogation_Position=1092; Antisense; ATGATTGCTTCATTCCACCTGAAAC
>probe:Drosophila_2:1636980_s_at:147:659; Interrogation_Position=1185; Antisense; TAAGCCAAAGTTCATATCCACCTCG
>probe:Drosophila_2:1636980_s_at:357:289; Interrogation_Position=1208; Antisense; CGGCACTATCTCACATGGCAATTTA
>probe:Drosophila_2:1636980_s_at:463:257; Interrogation_Position=769; Antisense; CACAACGGCGACATGCAGGGCAGTT
>probe:Drosophila_2:1636980_s_at:120:387; Interrogation_Position=804; Antisense; GAACAATGCTCCCAAGTACCAAGTG
>probe:Drosophila_2:1636980_s_at:581:27; Interrogation_Position=838; Antisense; ATACGCGTCATTCTCGACTGCGAGG
>probe:Drosophila_2:1636980_s_at:564:435; Interrogation_Position=859; Antisense; GAGGACAACACCTTGTCGTTCGAGA
>probe:Drosophila_2:1636980_s_at:513:107; Interrogation_Position=884; Antisense; AGAACTACGAGTTCCTCGGTGTGGC
>probe:Drosophila_2:1636980_s_at:349:523; Interrogation_Position=915; Antisense; GGGCCTGCCGGACAAAAAGCTCTAT
>probe:Drosophila_2:1636980_s_at:624:153; Interrogation_Position=943; Antisense; ACAGTATCCGCTGTCTACGGCAATA
>probe:Drosophila_2:1636980_s_at:590:79; Interrogation_Position=971; Antisense; AGGTCTCGATGGTCTATCTGGGCAC
>probe:Drosophila_2:1636980_s_at:272:317; Interrogation_Position=996; Antisense; GCCGTTGGACGGATAGCTTTGCAGA

Paste this into a BLAST search page for me
GCAGAGGGCCTACAACTTGGTTAACGGTTAACAACTTCCACGGATCCATTATGATTGCTTCATTCCACCTGAAACTAAGCCAAAGTTCATATCCACCTCGCGGCACTATCTCACATGGCAATTTACACAACGGCGACATGCAGGGCAGTTGAACAATGCTCCCAAGTACCAAGTGATACGCGTCATTCTCGACTGCGAGGGAGGACAACACCTTGTCGTTCGAGAAGAACTACGAGTTCCTCGGTGTGGCGGGCCTGCCGGACAAAAAGCTCTATACAGTATCCGCTGTCTACGGCAATAAGGTCTCGATGGTCTATCTGGGCACGCCGTTGGACGGATAGCTTTGCAGA

Full Affymetrix probeset data:

Annotations for 1636980_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime