Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636984_at:

>probe:Drosophila_2:1636984_at:562:631; Interrogation_Position=7051; Antisense; TCCGAGTTCCAAGAGGTTACAGCAT
>probe:Drosophila_2:1636984_at:35:201; Interrogation_Position=7076; Antisense; AACGCTATACGTGATGACTGTGCTG
>probe:Drosophila_2:1636984_at:715:55; Interrogation_Position=7089; Antisense; ATGACTGTGCTGTTCGATAGTTTCG
>probe:Drosophila_2:1636984_at:54:415; Interrogation_Position=7154; Antisense; GACCATATTCACCAATTCGGACATA
>probe:Drosophila_2:1636984_at:323:461; Interrogation_Position=7199; Antisense; GATTACATCTACCAACGAGCTGCGT
>probe:Drosophila_2:1636984_at:549:283; Interrogation_Position=7218; Antisense; CTGCGTCTCGAAAGCCGTCAAGTAT
>probe:Drosophila_2:1636984_at:521:215; Interrogation_Position=7237; Antisense; AAGTATCGTCCCTCAAGTTCTTCTA
>probe:Drosophila_2:1636984_at:408:93; Interrogation_Position=7252; Antisense; AGTTCTTCTACTTTTCCACCAGCAA
>probe:Drosophila_2:1636984_at:144:351; Interrogation_Position=7327; Antisense; GCAGCTATCTGGAGAATCCCTCCTA
>probe:Drosophila_2:1636984_at:681:105; Interrogation_Position=7339; Antisense; AGAATCCCTCCTACGAAGGACGCAA
>probe:Drosophila_2:1636984_at:334:411; Interrogation_Position=7357; Antisense; GACGCAACAGCTCATTGTGCACTTG
>probe:Drosophila_2:1636984_at:90:623; Interrogation_Position=7387; Antisense; TATCCGTACCAGCTGGCGGAAGTCT
>probe:Drosophila_2:1636984_at:603:717; Interrogation_Position=7422; Antisense; TTCGCAGAATTCAACATGGGCTCGG
>probe:Drosophila_2:1636984_at:194:681; Interrogation_Position=7479; Antisense; TATGACAGCGTTGTTGACGACCAAA

Paste this into a BLAST search page for me
TCCGAGTTCCAAGAGGTTACAGCATAACGCTATACGTGATGACTGTGCTGATGACTGTGCTGTTCGATAGTTTCGGACCATATTCACCAATTCGGACATAGATTACATCTACCAACGAGCTGCGTCTGCGTCTCGAAAGCCGTCAAGTATAAGTATCGTCCCTCAAGTTCTTCTAAGTTCTTCTACTTTTCCACCAGCAAGCAGCTATCTGGAGAATCCCTCCTAAGAATCCCTCCTACGAAGGACGCAAGACGCAACAGCTCATTGTGCACTTGTATCCGTACCAGCTGGCGGAAGTCTTTCGCAGAATTCAACATGGGCTCGGTATGACAGCGTTGTTGACGACCAAA

Full Affymetrix probeset data:

Annotations for 1636984_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime