Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636985_s_at:

>probe:Drosophila_2:1636985_s_at:401:217; Interrogation_Position=114; Antisense; AAGTTTTGCAGTTGTACATTCGAAA
>probe:Drosophila_2:1636985_s_at:9:299; Interrogation_Position=14; Antisense; CGCGCTGTATTTTATTTTAGTTGAC
>probe:Drosophila_2:1636985_s_at:98:491; Interrogation_Position=148; Antisense; GTAAATACTTTCATCCTCCTGGTAA
>probe:Drosophila_2:1636985_s_at:21:217; Interrogation_Position=173; Antisense; AATACCCACCCTCAGTGAGCGGTAA
>probe:Drosophila_2:1636985_s_at:172:511; Interrogation_Position=187; Antisense; GTGAGCGGTAACTATGATCAGCCAA
>probe:Drosophila_2:1636985_s_at:29:683; Interrogation_Position=199; Antisense; TATGATCAGCCAAGCGTTTTCCCAG
>probe:Drosophila_2:1636985_s_at:409:195; Interrogation_Position=210; Antisense; AAGCGTTTTCCCAGTGGGCTCAAAG
>probe:Drosophila_2:1636985_s_at:92:267; Interrogation_Position=221; Antisense; CAGTGGGCTCAAAGTTATCGTGTCT
>probe:Drosophila_2:1636985_s_at:373:17; Interrogation_Position=27; Antisense; ATTTTAGTTGACTTCATGTGTGCAT
>probe:Drosophila_2:1636985_s_at:717:269; Interrogation_Position=41; Antisense; CATGTGTGCATTGTCGTTCTGTGAG
>probe:Drosophila_2:1636985_s_at:569:637; Interrogation_Position=54; Antisense; TCGTTCTGTGAGTGCGCGAATCCAA
>probe:Drosophila_2:1636985_s_at:142:513; Interrogation_Position=61; Antisense; GTGAGTGCGCGAATCCAACTAGAGT
>probe:Drosophila_2:1636985_s_at:629:47; Interrogation_Position=73; Antisense; ATCCAACTAGAGTTCCGCTTCGTCT
>probe:Drosophila_2:1636985_s_at:322:639; Interrogation_Position=92; Antisense; TCGTCTCTGCCAAGTAGCGAAGAAG

Paste this into a BLAST search page for me
AAGTTTTGCAGTTGTACATTCGAAACGCGCTGTATTTTATTTTAGTTGACGTAAATACTTTCATCCTCCTGGTAAAATACCCACCCTCAGTGAGCGGTAAGTGAGCGGTAACTATGATCAGCCAATATGATCAGCCAAGCGTTTTCCCAGAAGCGTTTTCCCAGTGGGCTCAAAGCAGTGGGCTCAAAGTTATCGTGTCTATTTTAGTTGACTTCATGTGTGCATCATGTGTGCATTGTCGTTCTGTGAGTCGTTCTGTGAGTGCGCGAATCCAAGTGAGTGCGCGAATCCAACTAGAGTATCCAACTAGAGTTCCGCTTCGTCTTCGTCTCTGCCAAGTAGCGAAGAAG

Full Affymetrix probeset data:

Annotations for 1636985_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime