Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636986_at:

>probe:Drosophila_2:1636986_at:227:133; Interrogation_Position=3016; Antisense; ACGCCGATACGTATGTGGACAAGTT
>probe:Drosophila_2:1636986_at:326:509; Interrogation_Position=3032; Antisense; GGACAAGTTTAAGCCCTTCCTAATG
>probe:Drosophila_2:1636986_at:432:205; Interrogation_Position=3042; Antisense; AAGCCCTTCCTAATGGACGTGGTGC
>probe:Drosophila_2:1636986_at:549:721; Interrogation_Position=3094; Antisense; TTGCCGTCTGCAAGATGACCGACAT
>probe:Drosophila_2:1636986_at:727:609; Interrogation_Position=3109; Antisense; TGACCGACATCTTCGAAGGCTCCAT
>probe:Drosophila_2:1636986_at:244:37; Interrogation_Position=3132; Antisense; ATCATCCGCTGCATGAGGCGACTGG
>probe:Drosophila_2:1636986_at:383:407; Interrogation_Position=3151; Antisense; GACTGGAGGAGCTTCTGCGCCAGAT
>probe:Drosophila_2:1636986_at:166:443; Interrogation_Position=3173; Antisense; GATGTGCCAGGCCTCGAAGACCATT
>probe:Drosophila_2:1636986_at:665:369; Interrogation_Position=3188; Antisense; GAAGACCATTGGCAACACGGACCTG
>probe:Drosophila_2:1636986_at:610:365; Interrogation_Position=3232; Antisense; GAATAAGGCTGCTCAAGCGTGACAT
>probe:Drosophila_2:1636986_at:346:207; Interrogation_Position=3246; Antisense; AAGCGTGACATTGTCTTTGCCGCGT
>probe:Drosophila_2:1636986_at:396:625; Interrogation_Position=3263; Antisense; TGCCGCGTCGTTGTATCTGTAAGAT
>probe:Drosophila_2:1636986_at:68:259; Interrogation_Position=3319; Antisense; CACTTCCGTTCCAATCGTATTTTAT
>probe:Drosophila_2:1636986_at:351:215; Interrogation_Position=3443; Antisense; AAGATTTCCGAACCTTGCAATTATT

Paste this into a BLAST search page for me
ACGCCGATACGTATGTGGACAAGTTGGACAAGTTTAAGCCCTTCCTAATGAAGCCCTTCCTAATGGACGTGGTGCTTGCCGTCTGCAAGATGACCGACATTGACCGACATCTTCGAAGGCTCCATATCATCCGCTGCATGAGGCGACTGGGACTGGAGGAGCTTCTGCGCCAGATGATGTGCCAGGCCTCGAAGACCATTGAAGACCATTGGCAACACGGACCTGGAATAAGGCTGCTCAAGCGTGACATAAGCGTGACATTGTCTTTGCCGCGTTGCCGCGTCGTTGTATCTGTAAGATCACTTCCGTTCCAATCGTATTTTATAAGATTTCCGAACCTTGCAATTATT

Full Affymetrix probeset data:

Annotations for 1636986_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime