FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636988_at:

>probe:Drosophila_2:1636988_at:69:685; Interrogation_Position=380; Antisense; TATCAGACGCTCCATCGGGTAAACT
>probe:Drosophila_2:1636988_at:56:491; Interrogation_Position=398; Antisense; GTAAACTCCCGGCAGATCTACGACT
>probe:Drosophila_2:1636988_at:308:137; Interrogation_Position=417; Antisense; ACGACTCCAGACTCCGGATGCAGAA
>probe:Drosophila_2:1636988_at:510:157; Interrogation_Position=447; Antisense; ACAAATCTCCGCAAGAATCCACGTT
>probe:Drosophila_2:1636988_at:279:233; Interrogation_Position=462; Antisense; AATCCACGTTTACCGGCAGACGAGT
>probe:Drosophila_2:1636988_at:612:539; Interrogation_Position=493; Antisense; GGTTTGGTCACAGTATCAGTCCGCT
>probe:Drosophila_2:1636988_at:636:205; Interrogation_Position=566; Antisense; AAGCCCACCATCTTCAAGGGAAAGA
>probe:Drosophila_2:1636988_at:69:69; Interrogation_Position=601; Antisense; ATGGCTGCCAATGACCTTGGTTGAC
>probe:Drosophila_2:1636988_at:417:569; Interrogation_Position=654; Antisense; GGCATGATAAGTACTCCTTTCCCAA
>probe:Drosophila_2:1636988_at:696:555; Interrogation_Position=725; Antisense; GGACTGGTTCTATTGGACGTGATCA
>probe:Drosophila_2:1636988_at:214:49; Interrogation_Position=834; Antisense; ATCCAATCCATCCATCTGCATAGTT
>probe:Drosophila_2:1636988_at:156:679; Interrogation_Position=854; Antisense; TAGTTTTACTACCTCATCCATATGC
>probe:Drosophila_2:1636988_at:466:453; Interrogation_Position=882; Antisense; GATCATTGCTTTTGTTGTACTCCCT
>probe:Drosophila_2:1636988_at:427:665; Interrogation_Position=899; Antisense; TACTCCCTGGTCTCGTTTGAAAGAA

Paste this into a BLAST search page for me
TATCAGACGCTCCATCGGGTAAACTGTAAACTCCCGGCAGATCTACGACTACGACTCCAGACTCCGGATGCAGAAACAAATCTCCGCAAGAATCCACGTTAATCCACGTTTACCGGCAGACGAGTGGTTTGGTCACAGTATCAGTCCGCTAAGCCCACCATCTTCAAGGGAAAGAATGGCTGCCAATGACCTTGGTTGACGGCATGATAAGTACTCCTTTCCCAAGGACTGGTTCTATTGGACGTGATCAATCCAATCCATCCATCTGCATAGTTTAGTTTTACTACCTCATCCATATGCGATCATTGCTTTTGTTGTACTCCCTTACTCCCTGGTCTCGTTTGAAAGAA

Full Affymetrix probeset data:

Annotations for 1636988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720