Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636990_at:

>probe:Drosophila_2:1636990_at:643:665; Interrogation_Position=3031; Antisense; TACAACTGATCCCAGAATCCCTATT
>probe:Drosophila_2:1636990_at:154:263; Interrogation_Position=3043; Antisense; CAGAATCCCTATTCCGACAAAGGCG
>probe:Drosophila_2:1636990_at:520:225; Interrogation_Position=3062; Antisense; AAGGCGGCCACTTCACTTATTATAA
>probe:Drosophila_2:1636990_at:525:435; Interrogation_Position=3088; Antisense; GAGGTGATCACCAGCTGAATGACTT
>probe:Drosophila_2:1636990_at:204:159; Interrogation_Position=3120; Antisense; TAAGTAAAACTTATCGGGCCTGTTG
>probe:Drosophila_2:1636990_at:96:579; Interrogation_Position=3136; Antisense; GGCCTGTTGCGGTTTTCACATATTT
>probe:Drosophila_2:1636990_at:494:203; Interrogation_Position=3228; Antisense; TAACCAAAGGTGTGCAATACGGAAT
>probe:Drosophila_2:1636990_at:455:475; Interrogation_Position=3366; Antisense; GTTAGCCACTGATAAGCCAATCGAG
>probe:Drosophila_2:1636990_at:593:43; Interrogation_Position=3385; Antisense; ATCGAGATAGCACAGCCTGCATTTC
>probe:Drosophila_2:1636990_at:316:155; Interrogation_Position=3396; Antisense; ACAGCCTGCATTTCACCGAATAATA
>probe:Drosophila_2:1636990_at:84:655; Interrogation_Position=3416; Antisense; TAATAACTATTTTTTCGCACGGCCT
>probe:Drosophila_2:1636990_at:473:717; Interrogation_Position=3429; Antisense; TTCGCACGGCCTAAAATGTCTAGAT
>probe:Drosophila_2:1636990_at:497:393; Interrogation_Position=3517; Antisense; GAGACTTTATTGTGTTTGCTTAATT
>probe:Drosophila_2:1636990_at:617:345; Interrogation_Position=3543; Antisense; GCATAAGTTGTGTACCGATTTTGAA

Paste this into a BLAST search page for me
TACAACTGATCCCAGAATCCCTATTCAGAATCCCTATTCCGACAAAGGCGAAGGCGGCCACTTCACTTATTATAAGAGGTGATCACCAGCTGAATGACTTTAAGTAAAACTTATCGGGCCTGTTGGGCCTGTTGCGGTTTTCACATATTTTAACCAAAGGTGTGCAATACGGAATGTTAGCCACTGATAAGCCAATCGAGATCGAGATAGCACAGCCTGCATTTCACAGCCTGCATTTCACCGAATAATATAATAACTATTTTTTCGCACGGCCTTTCGCACGGCCTAAAATGTCTAGATGAGACTTTATTGTGTTTGCTTAATTGCATAAGTTGTGTACCGATTTTGAA

Full Affymetrix probeset data:

Annotations for 1636990_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime