FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636995_at:

>probe:Drosophila_2:1636995_at:614:513; Interrogation_Position=1021; Antisense; GTGTACGACTACTTCAACTACCAGT
>probe:Drosophila_2:1636995_at:342:75; Interrogation_Position=1103; Antisense; AGGAGCTGGTCATCCCCGAGAGCGA
>probe:Drosophila_2:1636995_at:103:397; Interrogation_Position=1126; Antisense; GACAATCCGGTGTCCTAGGCAGGAG
>probe:Drosophila_2:1636995_at:617:113; Interrogation_Position=1173; Antisense; AGCAGCAATCTCAAGTCCATATCTA
>probe:Drosophila_2:1636995_at:304:247; Interrogation_Position=1258; Antisense; CAAGGCGAACGTGCCAAGGCTGCCA
>probe:Drosophila_2:1636995_at:137:227; Interrogation_Position=1273; Antisense; AAGGCTGCCAGATGCTGTCCTGTTG
>probe:Drosophila_2:1636995_at:215:85; Interrogation_Position=758; Antisense; AGTGTCGCCAGGAGGACGATCACGC
>probe:Drosophila_2:1636995_at:718:137; Interrogation_Position=773; Antisense; ACGATCACGCCGAGGACGTCGAGAT
>probe:Drosophila_2:1636995_at:110:221; Interrogation_Position=802; Antisense; AAGTGCCTGTTCAACCTGGGCGTGA
>probe:Drosophila_2:1636995_at:336:637; Interrogation_Position=898; Antisense; TCGGGCAACGTTGGCATGGACTTTT
>probe:Drosophila_2:1636995_at:697:217; Interrogation_Position=931; Antisense; AAGTACGCCTACTACAATCCGAGAT
>probe:Drosophila_2:1636995_at:596:235; Interrogation_Position=946; Antisense; AATCCGAGATCGTGCATGGACTGCC
>probe:Drosophila_2:1636995_at:423:65; Interrogation_Position=961; Antisense; ATGGACTGCCTGTCGGAGTACCCGG
>probe:Drosophila_2:1636995_at:629:521; Interrogation_Position=985; Antisense; GTGGCCTTTCACTATGTGCACAGCA

Paste this into a BLAST search page for me
GTGTACGACTACTTCAACTACCAGTAGGAGCTGGTCATCCCCGAGAGCGAGACAATCCGGTGTCCTAGGCAGGAGAGCAGCAATCTCAAGTCCATATCTACAAGGCGAACGTGCCAAGGCTGCCAAAGGCTGCCAGATGCTGTCCTGTTGAGTGTCGCCAGGAGGACGATCACGCACGATCACGCCGAGGACGTCGAGATAAGTGCCTGTTCAACCTGGGCGTGATCGGGCAACGTTGGCATGGACTTTTAAGTACGCCTACTACAATCCGAGATAATCCGAGATCGTGCATGGACTGCCATGGACTGCCTGTCGGAGTACCCGGGTGGCCTTTCACTATGTGCACAGCA

Full Affymetrix probeset data:

Annotations for 1636995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720