FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636996_at:

>probe:Drosophila_2:1636996_at:249:219; Interrogation_Position=156; Antisense; AAGTCCGCAAGCTCAGGGATCACAA
>probe:Drosophila_2:1636996_at:235:39; Interrogation_Position=195; Antisense; ATCTGAATACTCAGCGTCGTCGCAT
>probe:Drosophila_2:1636996_at:126:347; Interrogation_Position=216; Antisense; GCATCCTACGCCTGTTGCAGGGAAA
>probe:Drosophila_2:1636996_at:137:657; Interrogation_Position=271; Antisense; TTTGCACAGGATTGGCGAACTCGTT
>probe:Drosophila_2:1636996_at:83:45; Interrogation_Position=299; Antisense; ATCGCAGAGCTCCATTCGGGTGTGA
>probe:Drosophila_2:1636996_at:282:399; Interrogation_Position=325; Antisense; GACACTCAATCAGCGTCTGGACAGA
>probe:Drosophila_2:1636996_at:110:423; Interrogation_Position=356; Antisense; GAGAATTCAACTTGCTCCATTTGCC
>probe:Drosophila_2:1636996_at:691:285; Interrogation_Position=380; Antisense; CTGTTGCCCTGGACGGACAACGGAA
>probe:Drosophila_2:1636996_at:160:159; Interrogation_Position=396; Antisense; ACAACGGAATACATCGCCTGGTCTC
>probe:Drosophila_2:1636996_at:29:21; Interrogation_Position=435; Antisense; ATTTGTTTGGCTCCAGCTGCATCCA
>probe:Drosophila_2:1636996_at:517:139; Interrogation_Position=519; Antisense; ACGTGCGCAGGATCTACAGTCCGAG
>probe:Drosophila_2:1636996_at:84:155; Interrogation_Position=534; Antisense; ACAGTCCGAGCTTTTTGTCTCATTA
>probe:Drosophila_2:1636996_at:610:413; Interrogation_Position=563; Antisense; GACCATCTCAGTTTTTGCGTTTTCA
>probe:Drosophila_2:1636996_at:502:191; Interrogation_Position=90; Antisense; AACTTGAGCGCACGGAGCAGCAGCA

Paste this into a BLAST search page for me
AAGTCCGCAAGCTCAGGGATCACAAATCTGAATACTCAGCGTCGTCGCATGCATCCTACGCCTGTTGCAGGGAAATTTGCACAGGATTGGCGAACTCGTTATCGCAGAGCTCCATTCGGGTGTGAGACACTCAATCAGCGTCTGGACAGAGAGAATTCAACTTGCTCCATTTGCCCTGTTGCCCTGGACGGACAACGGAAACAACGGAATACATCGCCTGGTCTCATTTGTTTGGCTCCAGCTGCATCCAACGTGCGCAGGATCTACAGTCCGAGACAGTCCGAGCTTTTTGTCTCATTAGACCATCTCAGTTTTTGCGTTTTCAAACTTGAGCGCACGGAGCAGCAGCA

Full Affymetrix probeset data:

Annotations for 1636996_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720