Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636997_at:

>probe:Drosophila_2:1636997_at:131:411; Interrogation_Position=1091; Antisense; GACGCAGTTGCTCCGTTTGTAGATA
>probe:Drosophila_2:1636997_at:729:543; Interrogation_Position=1132; Antisense; GGATATACCTCTGGACATGTGCTCA
>probe:Drosophila_2:1636997_at:348:269; Interrogation_Position=1147; Antisense; CATGTGCTCAGGGAAACGTCTGCAA
>probe:Drosophila_2:1636997_at:336:531; Interrogation_Position=1174; Antisense; GGTGGCCAATAAAACCGACACTTTG
>probe:Drosophila_2:1636997_at:218:207; Interrogation_Position=1226; Antisense; AAGCTGTCCAACGTGTTAGCCATAT
>probe:Drosophila_2:1636997_at:87:707; Interrogation_Position=1241; Antisense; TTAGCCATATCATGCCATAAGCCCG
>probe:Drosophila_2:1636997_at:100:309; Interrogation_Position=1254; Antisense; GCCATAAGCCCGATAAGATGCCCGT
>probe:Drosophila_2:1636997_at:383:215; Interrogation_Position=1268; Antisense; AAGATGCCCGTGTTTCTGGGATCAC
>probe:Drosophila_2:1636997_at:421:551; Interrogation_Position=1333; Antisense; GGAGAATCCACGCATCACAAACACA
>probe:Drosophila_2:1636997_at:309:195; Interrogation_Position=1371; Antisense; AACTGGAGCGCTGCATTGAGAACAT
>probe:Drosophila_2:1636997_at:449:671; Interrogation_Position=1407; Antisense; TACGAGATTACAGACCCGACGTTTA
>probe:Drosophila_2:1636997_at:78:651; Interrogation_Position=1491; Antisense; TCACCGGACACATCAGCTGCGAAGA
>probe:Drosophila_2:1636997_at:200:29; Interrogation_Position=1517; Antisense; ATACTCGACGTGGTCTTCAAGGACT
>probe:Drosophila_2:1636997_at:164:469; Interrogation_Position=1580; Antisense; GTTGCGAAGATTACACTGCCCATGT

Paste this into a BLAST search page for me
GACGCAGTTGCTCCGTTTGTAGATAGGATATACCTCTGGACATGTGCTCACATGTGCTCAGGGAAACGTCTGCAAGGTGGCCAATAAAACCGACACTTTGAAGCTGTCCAACGTGTTAGCCATATTTAGCCATATCATGCCATAAGCCCGGCCATAAGCCCGATAAGATGCCCGTAAGATGCCCGTGTTTCTGGGATCACGGAGAATCCACGCATCACAAACACAAACTGGAGCGCTGCATTGAGAACATTACGAGATTACAGACCCGACGTTTATCACCGGACACATCAGCTGCGAAGAATACTCGACGTGGTCTTCAAGGACTGTTGCGAAGATTACACTGCCCATGT

Full Affymetrix probeset data:

Annotations for 1636997_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime