Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636998_at:

>probe:Drosophila_2:1636998_at:518:269; Interrogation_Position=3237; Antisense; CATGTAAGAGGCCTAATCTCGATTA
>probe:Drosophila_2:1636998_at:411:39; Interrogation_Position=3252; Antisense; ATCTCGATTAGGCTCATCTCAGACA
>probe:Drosophila_2:1636998_at:620:239; Interrogation_Position=3280; Antisense; AATAAATATACAAACGGACTCGCGG
>probe:Drosophila_2:1636998_at:80:555; Interrogation_Position=3295; Antisense; GGACTCGCGGAGAAGAGAACTTTCT
>probe:Drosophila_2:1636998_at:720:419; Interrogation_Position=3309; Antisense; GAGAACTTTCTAGCCTAAGTCACCA
>probe:Drosophila_2:1636998_at:694:315; Interrogation_Position=3321; Antisense; GCCTAAGTCACCATATCAGTCATAT
>probe:Drosophila_2:1636998_at:323:677; Interrogation_Position=3406; Antisense; TAGGGTATACGCATCCGTTTTCCCG
>probe:Drosophila_2:1636998_at:293:719; Interrogation_Position=3425; Antisense; TTCCCGCTTACTAAATATCTGCTTC
>probe:Drosophila_2:1636998_at:143:617; Interrogation_Position=3444; Antisense; TGCTTCAGTCCAAAACCAAACCGAT
>probe:Drosophila_2:1636998_at:678:459; Interrogation_Position=3466; Antisense; GATTTCCCTAAACCAACCCATGGAG
>probe:Drosophila_2:1636998_at:521:431; Interrogation_Position=3488; Antisense; GAGTCGCATGCCAAAGAGATCAAGT
>probe:Drosophila_2:1636998_at:708:263; Interrogation_Position=3525; Antisense; CAGATCATATGCAAGTTTTTACGAA
>probe:Drosophila_2:1636998_at:568:387; Interrogation_Position=3751; Antisense; GAAAGCTTGGCCCTTAGACCGGCGT
>probe:Drosophila_2:1636998_at:184:675; Interrogation_Position=3765; Antisense; TAGACCGGCGTATTTTACAATAAAT

Paste this into a BLAST search page for me
CATGTAAGAGGCCTAATCTCGATTAATCTCGATTAGGCTCATCTCAGACAAATAAATATACAAACGGACTCGCGGGGACTCGCGGAGAAGAGAACTTTCTGAGAACTTTCTAGCCTAAGTCACCAGCCTAAGTCACCATATCAGTCATATTAGGGTATACGCATCCGTTTTCCCGTTCCCGCTTACTAAATATCTGCTTCTGCTTCAGTCCAAAACCAAACCGATGATTTCCCTAAACCAACCCATGGAGGAGTCGCATGCCAAAGAGATCAAGTCAGATCATATGCAAGTTTTTACGAAGAAAGCTTGGCCCTTAGACCGGCGTTAGACCGGCGTATTTTACAATAAAT

Full Affymetrix probeset data:

Annotations for 1636998_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime