FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637002_at:

>probe:Drosophila_2:1637002_at:300:445; Interrogation_Position=202; Antisense; GATGAACCATGGAAGCCCACTGCTA
>probe:Drosophila_2:1637002_at:417:321; Interrogation_Position=252; Antisense; GCCCTCGAACATTACATCTACTGAA
>probe:Drosophila_2:1637002_at:405:387; Interrogation_Position=295; Antisense; GAAAATCCATTGAATCCCACGGGAA
>probe:Drosophila_2:1637002_at:433:413; Interrogation_Position=343; Antisense; GAGCCAACCGAAGAATCCACTGAAA
>probe:Drosophila_2:1637002_at:550:715; Interrogation_Position=510; Antisense; TTCGGATTCCACTGAAGAGCCCACT
>probe:Drosophila_2:1637002_at:284:103; Interrogation_Position=525; Antisense; AGAGCCCACTGGAGAACCATCAATT
>probe:Drosophila_2:1637002_at:9:655; Interrogation_Position=544; Antisense; TCAATTCCCACGCATGAGCCAGAAG
>probe:Drosophila_2:1637002_at:513:523; Interrogation_Position=576; Antisense; GGGCGATCCATCAGATCCGACAAGT
>probe:Drosophila_2:1637002_at:51:245; Interrogation_Position=615; Antisense; AATTCCCAACGTGGATGCGAACGCC
>probe:Drosophila_2:1637002_at:698:381; Interrogation_Position=633; Antisense; GAACGCCTCCTGTAGAGCTCATCAA
>probe:Drosophila_2:1637002_at:414:81; Interrogation_Position=657; Antisense; AGGTGTGCAATTTCTGCCACATCCG
>probe:Drosophila_2:1637002_at:196:313; Interrogation_Position=672; Antisense; GCCACATCCGTACGATTGTCATTTA
>probe:Drosophila_2:1637002_at:205:79; Interrogation_Position=742; Antisense; AGTGATCTGTACTGGAACTCGGTAA
>probe:Drosophila_2:1637002_at:58:403; Interrogation_Position=771; Antisense; GACTTGCGACAAGACCTGTGCCTAA

Paste this into a BLAST search page for me
GATGAACCATGGAAGCCCACTGCTAGCCCTCGAACATTACATCTACTGAAGAAAATCCATTGAATCCCACGGGAAGAGCCAACCGAAGAATCCACTGAAATTCGGATTCCACTGAAGAGCCCACTAGAGCCCACTGGAGAACCATCAATTTCAATTCCCACGCATGAGCCAGAAGGGGCGATCCATCAGATCCGACAAGTAATTCCCAACGTGGATGCGAACGCCGAACGCCTCCTGTAGAGCTCATCAAAGGTGTGCAATTTCTGCCACATCCGGCCACATCCGTACGATTGTCATTTAAGTGATCTGTACTGGAACTCGGTAAGACTTGCGACAAGACCTGTGCCTAA

Full Affymetrix probeset data:

Annotations for 1637002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720