FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637003_at:

>probe:Drosophila_2:1637003_at:19:593; Interrogation_Position=1278; Antisense; TGGGCGGTGCCGGTTTCAACAATTA
>probe:Drosophila_2:1637003_at:302:1; Interrogation_Position=1299; Antisense; ATTACCTAACCGTCAATTTGCCCAT
>probe:Drosophila_2:1637003_at:343:19; Interrogation_Position=1314; Antisense; ATTTGCCCATCACCACGATTAAGGA
>probe:Drosophila_2:1637003_at:280:77; Interrogation_Position=1335; Antisense; AGGAGGGCCAAGTTCTGGATCAGCA
>probe:Drosophila_2:1637003_at:488:589; Interrogation_Position=1350; Antisense; TGGATCAGCAGAGGACCAGCCGCGT
>probe:Drosophila_2:1637003_at:401:101; Interrogation_Position=1404; Antisense; AGAGTGCCTTTGGATCCATGGGCTC
>probe:Drosophila_2:1637003_at:273:143; Interrogation_Position=1439; Antisense; ACTGGAGCGATCAGTGCTGCCAGCA
>probe:Drosophila_2:1637003_at:475:427; Interrogation_Position=1517; Antisense; GAGATCGATCTGAGTGGCTGGACCA
>probe:Drosophila_2:1637003_at:469:659; Interrogation_Position=1545; Antisense; TAACGCCCCAGGAAATAGCCATGTG
>probe:Drosophila_2:1637003_at:248:87; Interrogation_Position=1577; Antisense; AGTCGAGCCAGATTCGTTTTTCCGC
>probe:Drosophila_2:1637003_at:141:641; Interrogation_Position=1602; Antisense; TCTCCTTTCTCGTCTTTAATCTGTT
>probe:Drosophila_2:1637003_at:241:219; Interrogation_Position=1724; Antisense; AAGTGTTTATTATTTGTACCCATCG
>probe:Drosophila_2:1637003_at:103:489; Interrogation_Position=1739; Antisense; GTACCCATCGTTTAGCATAGTTTGT
>probe:Drosophila_2:1637003_at:80:61; Interrogation_Position=1789; Antisense; ATGTTTGTTTCACTTTGTTCTGTAA

Paste this into a BLAST search page for me
TGGGCGGTGCCGGTTTCAACAATTAATTACCTAACCGTCAATTTGCCCATATTTGCCCATCACCACGATTAAGGAAGGAGGGCCAAGTTCTGGATCAGCATGGATCAGCAGAGGACCAGCCGCGTAGAGTGCCTTTGGATCCATGGGCTCACTGGAGCGATCAGTGCTGCCAGCAGAGATCGATCTGAGTGGCTGGACCATAACGCCCCAGGAAATAGCCATGTGAGTCGAGCCAGATTCGTTTTTCCGCTCTCCTTTCTCGTCTTTAATCTGTTAAGTGTTTATTATTTGTACCCATCGGTACCCATCGTTTAGCATAGTTTGTATGTTTGTTTCACTTTGTTCTGTAA

Full Affymetrix probeset data:

Annotations for 1637003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720