FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637004_at:

>probe:Drosophila_2:1637004_at:321:381; Interrogation_Position=1609; Antisense; GAACCGCTTGAAGTCCACCGAACAG
>probe:Drosophila_2:1637004_at:617:385; Interrogation_Position=1628; Antisense; GAACAGCGACCCGATTCATTGGGCG
>probe:Drosophila_2:1637004_at:63:441; Interrogation_Position=1655; Antisense; GAGGCCTTGAAACGCCACTGCGATG
>probe:Drosophila_2:1637004_at:49:323; Interrogation_Position=1762; Antisense; GCCCACGCCCATTAAGAAGCTGCAA
>probe:Drosophila_2:1637004_at:363:661; Interrogation_Position=1812; Antisense; TAAACGTTTCCATGCGGGAGTTGCC
>probe:Drosophila_2:1637004_at:581:197; Interrogation_Position=1856; Antisense; AACGAGCTCCTGGATCGCAGCAGTG
>probe:Drosophila_2:1637004_at:728:275; Interrogation_Position=1884; Antisense; CTTTCGGCGGAGTGCGCAAGACGCT
>probe:Drosophila_2:1637004_at:68:329; Interrogation_Position=1909; Antisense; GCGTAGGCGCTCTCTGGAATAGTGA
>probe:Drosophila_2:1637004_at:667:313; Interrogation_Position=1945; Antisense; GCCAGAGGAGACTTCTTCAGCCAGC
>probe:Drosophila_2:1637004_at:427:127; Interrogation_Position=1963; Antisense; AGCCAGCCCCATATCAGATTTGTTT
>probe:Drosophila_2:1637004_at:346:381; Interrogation_Position=2025; Antisense; GAACGCCGCATTTAAATGTGCACCA
>probe:Drosophila_2:1637004_at:444:597; Interrogation_Position=2041; Antisense; TGTGCACCACTATCGATAAGTCTCT
>probe:Drosophila_2:1637004_at:24:33; Interrogation_Position=2056; Antisense; ATAAGTCTCTACACCCACAGGATAT
>probe:Drosophila_2:1637004_at:234:727; Interrogation_Position=2126; Antisense; TTGTCTCCGTATATGTTTCTCACTG

Paste this into a BLAST search page for me
GAACCGCTTGAAGTCCACCGAACAGGAACAGCGACCCGATTCATTGGGCGGAGGCCTTGAAACGCCACTGCGATGGCCCACGCCCATTAAGAAGCTGCAATAAACGTTTCCATGCGGGAGTTGCCAACGAGCTCCTGGATCGCAGCAGTGCTTTCGGCGGAGTGCGCAAGACGCTGCGTAGGCGCTCTCTGGAATAGTGAGCCAGAGGAGACTTCTTCAGCCAGCAGCCAGCCCCATATCAGATTTGTTTGAACGCCGCATTTAAATGTGCACCATGTGCACCACTATCGATAAGTCTCTATAAGTCTCTACACCCACAGGATATTTGTCTCCGTATATGTTTCTCACTG

Full Affymetrix probeset data:

Annotations for 1637004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720