Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637006_at:

>probe:Drosophila_2:1637006_at:524:153; Interrogation_Position=2618; Antisense; ACAGTGGTTGGAGGTAGGCACACAC
>probe:Drosophila_2:1637006_at:280:467; Interrogation_Position=2624; Antisense; GTTGGAGGTAGGCACACACACAGAC
>probe:Drosophila_2:1637006_at:409:549; Interrogation_Position=2627; Antisense; GGAGGTAGGCACACACACAGACCCA
>probe:Drosophila_2:1637006_at:232:129; Interrogation_Position=2651; Antisense; ACCAGCCCATCAACACTCAAAACTA
>probe:Drosophila_2:1637006_at:646:137; Interrogation_Position=2665; Antisense; ACTCAAAACTACACCCACATCGAAA
>probe:Drosophila_2:1637006_at:588:279; Interrogation_Position=2673; Antisense; CTACACCCACATCGAAACACATTTA
>probe:Drosophila_2:1637006_at:688:151; Interrogation_Position=2681; Antisense; ACATCGAAACACATTTACACACGCA
>probe:Drosophila_2:1637006_at:373:665; Interrogation_Position=2712; Antisense; TACAAAGCGCATCGCGCACAGATGC
>probe:Drosophila_2:1637006_at:648:123; Interrogation_Position=2717; Antisense; AGCGCATCGCGCACAGATGCAAGAT
>probe:Drosophila_2:1637006_at:59:325; Interrogation_Position=2725; Antisense; GCGCACAGATGCAAGATACAACCGA
>probe:Drosophila_2:1637006_at:577:215; Interrogation_Position=2737; Antisense; AAGATACAACCGAGCACACGCATCC
>probe:Drosophila_2:1637006_at:230:131; Interrogation_Position=2745; Antisense; ACCGAGCACACGCATCCAAAAGATT
>probe:Drosophila_2:1637006_at:427:421; Interrogation_Position=2748; Antisense; GAGCACACGCATCCAAAAGATTGAA
>probe:Drosophila_2:1637006_at:391:171; Interrogation_Position=2771; Antisense; AAAGATGAAGAGCTTGAGCAGCGCT

Paste this into a BLAST search page for me
ACAGTGGTTGGAGGTAGGCACACACGTTGGAGGTAGGCACACACACAGACGGAGGTAGGCACACACACAGACCCAACCAGCCCATCAACACTCAAAACTAACTCAAAACTACACCCACATCGAAACTACACCCACATCGAAACACATTTAACATCGAAACACATTTACACACGCATACAAAGCGCATCGCGCACAGATGCAGCGCATCGCGCACAGATGCAAGATGCGCACAGATGCAAGATACAACCGAAAGATACAACCGAGCACACGCATCCACCGAGCACACGCATCCAAAAGATTGAGCACACGCATCCAAAAGATTGAAAAAGATGAAGAGCTTGAGCAGCGCT

Full Affymetrix probeset data:

Annotations for 1637006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime