FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637008_at:

>probe:Drosophila_2:1637008_at:279:43; Interrogation_Position=172; Antisense; ATCGTCCTTGCAGTCCGAAGAGAGT
>probe:Drosophila_2:1637008_at:126:463; Interrogation_Position=208; Antisense; GATTCAGGCCGGATTTCGTGGCTAC
>probe:Drosophila_2:1637008_at:632:639; Interrogation_Position=223; Antisense; TCGTGGCTACCGTGTGCGCAAAGAG
>probe:Drosophila_2:1637008_at:279:449; Interrogation_Position=247; Antisense; GATCCATCGATCCAGCAAGAATCCC
>probe:Drosophila_2:1637008_at:54:575; Interrogation_Position=279; Antisense; GGCGGAATCAGCGACAGCGTCCAAA
>probe:Drosophila_2:1637008_at:32:387; Interrogation_Position=304; Antisense; GAACAACGGCCTCATGGAAAACCAG
>probe:Drosophila_2:1637008_at:172:437; Interrogation_Position=359; Antisense; GAGGATCAGCATACGGCCACCGAGA
>probe:Drosophila_2:1637008_at:336:589; Interrogation_Position=399; Antisense; TGGAGGATCGTAGTGCCACCAAGAT
>probe:Drosophila_2:1637008_at:238:309; Interrogation_Position=471; Antisense; CCACCGATGCCGCTGTTAAAATTCA
>probe:Drosophila_2:1637008_at:474:5; Interrogation_Position=548; Antisense; ATTGTGTAATGACTTTGCGCGCTGG
>probe:Drosophila_2:1637008_at:516:535; Interrogation_Position=571; Antisense; GGTCGTTCCACAACTCTGATTTCTA
>probe:Drosophila_2:1637008_at:114:727; Interrogation_Position=612; Antisense; TTGTATTCAAATCCTACCGCTTAGT
>probe:Drosophila_2:1637008_at:461:131; Interrogation_Position=627; Antisense; ACCGCTTAGTTCAATACGTGTCGTG
>probe:Drosophila_2:1637008_at:693:209; Interrogation_Position=723; Antisense; AAGACACCACTATCCATTAACGAGA

Paste this into a BLAST search page for me
ATCGTCCTTGCAGTCCGAAGAGAGTGATTCAGGCCGGATTTCGTGGCTACTCGTGGCTACCGTGTGCGCAAAGAGGATCCATCGATCCAGCAAGAATCCCGGCGGAATCAGCGACAGCGTCCAAAGAACAACGGCCTCATGGAAAACCAGGAGGATCAGCATACGGCCACCGAGATGGAGGATCGTAGTGCCACCAAGATCCACCGATGCCGCTGTTAAAATTCAATTGTGTAATGACTTTGCGCGCTGGGGTCGTTCCACAACTCTGATTTCTATTGTATTCAAATCCTACCGCTTAGTACCGCTTAGTTCAATACGTGTCGTGAAGACACCACTATCCATTAACGAGA

Full Affymetrix probeset data:

Annotations for 1637008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720