Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637009_at:

>probe:Drosophila_2:1637009_at:326:197; Interrogation_Position=5571; Antisense; AACGGTCCAGCAGCAGACGATTCAG
>probe:Drosophila_2:1637009_at:294:353; Interrogation_Position=5660; Antisense; GCAACGTCCAGGTGGTGGGCACCAA
>probe:Drosophila_2:1637009_at:684:679; Interrogation_Position=5726; Antisense; TAGGTGGCTCCACGCTTAAGATCGC
>probe:Drosophila_2:1637009_at:722:301; Interrogation_Position=5758; Antisense; CCCGTGAACGCTGCCAATGTGGTGA
>probe:Drosophila_2:1637009_at:601:229; Interrogation_Position=5773; Antisense; AATGTGGTGACCAGCAGCGCCAACC
>probe:Drosophila_2:1637009_at:194:279; Interrogation_Position=5797; Antisense; CTAACCACCACTCCGATTGTGATGT
>probe:Drosophila_2:1637009_at:252:513; Interrogation_Position=5815; Antisense; GTGATGTCCGCACAGAAGCTGCAAT
>probe:Drosophila_2:1637009_at:39:389; Interrogation_Position=5841; Antisense; GAAAACGGTGAAGGCGCCCGTGCAA
>probe:Drosophila_2:1637009_at:602:351; Interrogation_Position=5901; Antisense; GCAGCAACAGCACCGAATACTCAAC
>probe:Drosophila_2:1637009_at:483:365; Interrogation_Position=5915; Antisense; GAATACTCAACCAGCAGAGCACGGC
>probe:Drosophila_2:1637009_at:433:617; Interrogation_Position=6017; Antisense; TGCAGCACATTCAGATCGCCGGTAG
>probe:Drosophila_2:1637009_at:174:341; Interrogation_Position=6052; Antisense; GCTTCGGGAGCCATCAGTCAAAGGA
>probe:Drosophila_2:1637009_at:180:257; Interrogation_Position=6070; Antisense; CAAAGGACTCTAACAGCTCTGGCGG
>probe:Drosophila_2:1637009_at:432:189; Interrogation_Position=6119; Antisense; AACAGGCTGCGGTCAATCGACGGCG

Paste this into a BLAST search page for me
AACGGTCCAGCAGCAGACGATTCAGGCAACGTCCAGGTGGTGGGCACCAATAGGTGGCTCCACGCTTAAGATCGCCCCGTGAACGCTGCCAATGTGGTGAAATGTGGTGACCAGCAGCGCCAACCCTAACCACCACTCCGATTGTGATGTGTGATGTCCGCACAGAAGCTGCAATGAAAACGGTGAAGGCGCCCGTGCAAGCAGCAACAGCACCGAATACTCAACGAATACTCAACCAGCAGAGCACGGCTGCAGCACATTCAGATCGCCGGTAGGCTTCGGGAGCCATCAGTCAAAGGACAAAGGACTCTAACAGCTCTGGCGGAACAGGCTGCGGTCAATCGACGGCG

Full Affymetrix probeset data:

Annotations for 1637009_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime