Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637011_at:

>probe:Drosophila_2:1637011_at:730:543; Interrogation_Position=4234; Antisense; GGATATACTGCCAAGCCGGTCAAGT
>probe:Drosophila_2:1637011_at:90:251; Interrogation_Position=4277; Antisense; CAATCTCGGACTTTCGCGAACTGAG
>probe:Drosophila_2:1637011_at:296:541; Interrogation_Position=4369; Antisense; GGTTACTTCTCCATCAAGCATATTG
>probe:Drosophila_2:1637011_at:207:21; Interrogation_Position=4388; Antisense; ATATTGCCTTAGAGCTGCACACCTA
>probe:Drosophila_2:1637011_at:610:161; Interrogation_Position=4412; Antisense; ACAATACCATGGCTCTGCAATGCAA
>probe:Drosophila_2:1637011_at:530:207; Interrogation_Position=4435; Antisense; AAGCTGATGAAGTTCTGCCGATCCA
>probe:Drosophila_2:1637011_at:601:337; Interrogation_Position=4510; Antisense; GCTAAGGACAACTCGGACTACTCGG
>probe:Drosophila_2:1637011_at:481:403; Interrogation_Position=4525; Antisense; GACTACTCGGAGGTCACAATGCGTA
>probe:Drosophila_2:1637011_at:374:49; Interrogation_Position=4543; Antisense; ATGCGTATTACACCCGAGAAGACAA
>probe:Drosophila_2:1637011_at:642:397; Interrogation_Position=4563; Antisense; GACAACCTTTGTCAAGATTTCCGAG
>probe:Drosophila_2:1637011_at:178:525; Interrogation_Position=4666; Antisense; GGGCAGGCCATTTATTCGCTTAATC
>probe:Drosophila_2:1637011_at:652:529; Interrogation_Position=4704; Antisense; GGGTTCCAATAAAGACGCGATGCTC
>probe:Drosophila_2:1637011_at:440:327; Interrogation_Position=4720; Antisense; GCGATGCTCTTCGTCTACTTAAAAA
>probe:Drosophila_2:1637011_at:529:461; Interrogation_Position=4758; Antisense; GATTCGTCCTTTAAGTTACTCCTAG

Paste this into a BLAST search page for me
GGATATACTGCCAAGCCGGTCAAGTCAATCTCGGACTTTCGCGAACTGAGGGTTACTTCTCCATCAAGCATATTGATATTGCCTTAGAGCTGCACACCTAACAATACCATGGCTCTGCAATGCAAAAGCTGATGAAGTTCTGCCGATCCAGCTAAGGACAACTCGGACTACTCGGGACTACTCGGAGGTCACAATGCGTAATGCGTATTACACCCGAGAAGACAAGACAACCTTTGTCAAGATTTCCGAGGGGCAGGCCATTTATTCGCTTAATCGGGTTCCAATAAAGACGCGATGCTCGCGATGCTCTTCGTCTACTTAAAAAGATTCGTCCTTTAAGTTACTCCTAG

Full Affymetrix probeset data:

Annotations for 1637011_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime