FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637012_at:

>probe:Drosophila_2:1637012_at:712:539; Interrogation_Position=381; Antisense; GGAGTCTATCCACAAGTACGGTCTG
>probe:Drosophila_2:1637012_at:710:289; Interrogation_Position=399; Antisense; CGGTCTGGAGCTGAGGCAATTGCCC
>probe:Drosophila_2:1637012_at:252:159; Interrogation_Position=458; Antisense; ACACACCCACATTGATTAGCAGCGT
>probe:Drosophila_2:1637012_at:111:521; Interrogation_Position=487; Antisense; GTGGACAAGGTCAGCGCCCAGAGCT
>probe:Drosophila_2:1637012_at:120:187; Interrogation_Position=612; Antisense; AACACAGTTGCCCAGTAATCTCTGG
>probe:Drosophila_2:1637012_at:332:655; Interrogation_Position=627; Antisense; TAATCTCTGGGATCTGCAGTTGCCC
>probe:Drosophila_2:1637012_at:406:667; Interrogation_Position=658; Antisense; TACATCAGCACGGACAATGGCACCT
>probe:Drosophila_2:1637012_at:280:229; Interrogation_Position=673; Antisense; AATGGCACCTTCTTCTGGGCCAACA
>probe:Drosophila_2:1637012_at:416:587; Interrogation_Position=710; Antisense; TGGACGATGATCTTCTGCACGCCTT
>probe:Drosophila_2:1637012_at:240:723; Interrogation_Position=733; Antisense; TTGCTTTGCCAGAGCTTCAGTCAGC
>probe:Drosophila_2:1637012_at:14:563; Interrogation_Position=763; Antisense; GGAACGCTCTGCTAGTTGTACTCCG
>probe:Drosophila_2:1637012_at:232:131; Interrogation_Position=797; Antisense; ACCTCATCCCATCACTGAATAGATC
>probe:Drosophila_2:1637012_at:186:713; Interrogation_Position=861; Antisense; TTCATTTATTTATTTCCCTGCGCAA
>probe:Drosophila_2:1637012_at:437:717; Interrogation_Position=874; Antisense; TTCCCTGCGCAATATTAACGTTGTT

Paste this into a BLAST search page for me
GGAGTCTATCCACAAGTACGGTCTGCGGTCTGGAGCTGAGGCAATTGCCCACACACCCACATTGATTAGCAGCGTGTGGACAAGGTCAGCGCCCAGAGCTAACACAGTTGCCCAGTAATCTCTGGTAATCTCTGGGATCTGCAGTTGCCCTACATCAGCACGGACAATGGCACCTAATGGCACCTTCTTCTGGGCCAACATGGACGATGATCTTCTGCACGCCTTTTGCTTTGCCAGAGCTTCAGTCAGCGGAACGCTCTGCTAGTTGTACTCCGACCTCATCCCATCACTGAATAGATCTTCATTTATTTATTTCCCTGCGCAATTCCCTGCGCAATATTAACGTTGTT

Full Affymetrix probeset data:

Annotations for 1637012_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720