FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637013_at:

>probe:Drosophila_2:1637013_at:655:119; Interrogation_Position=1004; Antisense; AGCTGTATACCGCTGCCAATCAGTC
>probe:Drosophila_2:1637013_at:469:615; Interrogation_Position=1085; Antisense; TGCACGGCGAGCTCCAGAGCGTCAT
>probe:Drosophila_2:1637013_at:75:153; Interrogation_Position=1115; Antisense; ACATCAGCAATGTGGGCGTGCGGCA
>probe:Drosophila_2:1637013_at:454:351; Interrogation_Position=1140; Antisense; GCAGCACAACATAATGGCCGGCGGG
>probe:Drosophila_2:1637013_at:251:131; Interrogation_Position=1184; Antisense; ACCTGACCCTGATCGGCAACTGCGG
>probe:Drosophila_2:1637013_at:277:195; Interrogation_Position=1201; Antisense; AACTGCGGCGCCTCGGTGAGGAACA
>probe:Drosophila_2:1637013_at:388:561; Interrogation_Position=1220; Antisense; GGAACATCGAGGACGGGAACAGTAA
>probe:Drosophila_2:1637013_at:142:153; Interrogation_Position=1238; Antisense; ACAGTAATCGGCAGGTGGCCGCCTT
>probe:Drosophila_2:1637013_at:147:269; Interrogation_Position=825; Antisense; CATGCTGGGCGCCAATCAGAACTTC
>probe:Drosophila_2:1637013_at:689:249; Interrogation_Position=837; Antisense; CAATCAGAACTTCCCGGGCATTGTC
>probe:Drosophila_2:1637013_at:281:525; Interrogation_Position=852; Antisense; GGGCATTGTCAACCAGGCGCAACAC
>probe:Drosophila_2:1637013_at:377:625; Interrogation_Position=945; Antisense; TGCCGCCGGATGCAATGGCTCACTG
>probe:Drosophila_2:1637013_at:558:51; Interrogation_Position=954; Antisense; ATGCAATGGCTCACTGTACCCCGTG
>probe:Drosophila_2:1637013_at:288:89; Interrogation_Position=988; Antisense; AGTCTGCTGTATTCCCAGCTGTATA

Paste this into a BLAST search page for me
AGCTGTATACCGCTGCCAATCAGTCTGCACGGCGAGCTCCAGAGCGTCATACATCAGCAATGTGGGCGTGCGGCAGCAGCACAACATAATGGCCGGCGGGACCTGACCCTGATCGGCAACTGCGGAACTGCGGCGCCTCGGTGAGGAACAGGAACATCGAGGACGGGAACAGTAAACAGTAATCGGCAGGTGGCCGCCTTCATGCTGGGCGCCAATCAGAACTTCCAATCAGAACTTCCCGGGCATTGTCGGGCATTGTCAACCAGGCGCAACACTGCCGCCGGATGCAATGGCTCACTGATGCAATGGCTCACTGTACCCCGTGAGTCTGCTGTATTCCCAGCTGTATA

Full Affymetrix probeset data:

Annotations for 1637013_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720