FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637014_at:

>probe:Drosophila_2:1637014_at:79:245; Interrogation_Position=1393; Antisense; AATTTTCGCTCAATTAACGCCCAGA
>probe:Drosophila_2:1637014_at:394:673; Interrogation_Position=1429; Antisense; TACCCCTCCGCAATTGTACGTTTAT
>probe:Drosophila_2:1637014_at:102:181; Interrogation_Position=1467; Antisense; AAAAGTCGCAGGCTAGTCGGAACTA
>probe:Drosophila_2:1637014_at:606:695; Interrogation_Position=1503; Antisense; TTACACTCGTGCCTTAATTAGATAG
>probe:Drosophila_2:1637014_at:376:65; Interrogation_Position=1535; Antisense; ATGGTGTAGTTCGTAGTGCCTGAAA
>probe:Drosophila_2:1637014_at:255:179; Interrogation_Position=1575; Antisense; AAACATACCTGAACGACTGACCTGC
>probe:Drosophila_2:1637014_at:560:405; Interrogation_Position=1589; Antisense; GACTGACCTGCGACTAACCATAGAG
>probe:Drosophila_2:1637014_at:629:191; Interrogation_Position=1630; Antisense; AACTTCAGCTAAGCTAGTGCCTTAA
>probe:Drosophila_2:1637014_at:202:493; Interrogation_Position=1674; Antisense; GTAAGCGAAACTCCGCCCATTAGTT
>probe:Drosophila_2:1637014_at:364:189; Interrogation_Position=1709; Antisense; AACATTCCCTTTTGAACTCGAATAT
>probe:Drosophila_2:1637014_at:10:21; Interrogation_Position=1730; Antisense; ATATTCCGCACAAGTTACCTTCTTT
>probe:Drosophila_2:1637014_at:322:537; Interrogation_Position=1770; Antisense; GGTCTGTATTAATCATCCGTCCTTT
>probe:Drosophila_2:1637014_at:252:47; Interrogation_Position=1784; Antisense; ATCCGTCCTTTGCACGTATTTGTAA
>probe:Drosophila_2:1637014_at:356:495; Interrogation_Position=1855; Antisense; GTCTTTTACCGTCCCATATACAATA

Paste this into a BLAST search page for me
AATTTTCGCTCAATTAACGCCCAGATACCCCTCCGCAATTGTACGTTTATAAAAGTCGCAGGCTAGTCGGAACTATTACACTCGTGCCTTAATTAGATAGATGGTGTAGTTCGTAGTGCCTGAAAAAACATACCTGAACGACTGACCTGCGACTGACCTGCGACTAACCATAGAGAACTTCAGCTAAGCTAGTGCCTTAAGTAAGCGAAACTCCGCCCATTAGTTAACATTCCCTTTTGAACTCGAATATATATTCCGCACAAGTTACCTTCTTTGGTCTGTATTAATCATCCGTCCTTTATCCGTCCTTTGCACGTATTTGTAAGTCTTTTACCGTCCCATATACAATA

Full Affymetrix probeset data:

Annotations for 1637014_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720