FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637017_at:

>probe:Drosophila_2:1637017_at:437:427; Interrogation_Position=4152; Antisense; GAGATATGTTTCACCTTCGCAAGAC
>probe:Drosophila_2:1637017_at:583:469; Interrogation_Position=4201; Antisense; GTTCGCATTTGGGAATCGGACCAGA
>probe:Drosophila_2:1637017_at:624:461; Interrogation_Position=4230; Antisense; GATTACGGCCAACAATACCATAGTG
>probe:Drosophila_2:1637017_at:33:143; Interrogation_Position=4269; Antisense; ACTGGAGTCGTACATCAACAATCTG
>probe:Drosophila_2:1637017_at:528:101; Interrogation_Position=4304; Antisense; AGAGTTACAACATGCGAGTCCTCGC
>probe:Drosophila_2:1637017_at:145:327; Interrogation_Position=4317; Antisense; GCGAGTCCTCGCATACAGCAATGGA
>probe:Drosophila_2:1637017_at:202:73; Interrogation_Position=4341; Antisense; AGGAGACGGTCGCATGTCCAGTCCA
>probe:Drosophila_2:1637017_at:45:267; Interrogation_Position=4359; Antisense; CAGTCCAACTTTACACTTCCAGATG
>probe:Drosophila_2:1637017_at:563:719; Interrogation_Position=4375; Antisense; TTCCAGATGGGCAAGACCACGCGCA
>probe:Drosophila_2:1637017_at:132:163; Interrogation_Position=4407; Antisense; AAATACCCGACATGGCCACAATATC
>probe:Drosophila_2:1637017_at:394:23; Interrogation_Position=4427; Antisense; ATATCAATACGGCTCTTATCTTAAG
>probe:Drosophila_2:1637017_at:248:707; Interrogation_Position=4466; Antisense; TTAGCACCTTTCTTTACACAAGCCA
>probe:Drosophila_2:1637017_at:275:173; Interrogation_Position=4585; Antisense; AAAGAACTACATTCCATCCGTGCTC
>probe:Drosophila_2:1637017_at:62:645; Interrogation_Position=4610; Antisense; TCTTGCAAGCCCCTTAATTGATACA

Paste this into a BLAST search page for me
GAGATATGTTTCACCTTCGCAAGACGTTCGCATTTGGGAATCGGACCAGAGATTACGGCCAACAATACCATAGTGACTGGAGTCGTACATCAACAATCTGAGAGTTACAACATGCGAGTCCTCGCGCGAGTCCTCGCATACAGCAATGGAAGGAGACGGTCGCATGTCCAGTCCACAGTCCAACTTTACACTTCCAGATGTTCCAGATGGGCAAGACCACGCGCAAAATACCCGACATGGCCACAATATCATATCAATACGGCTCTTATCTTAAGTTAGCACCTTTCTTTACACAAGCCAAAAGAACTACATTCCATCCGTGCTCTCTTGCAAGCCCCTTAATTGATACA

Full Affymetrix probeset data:

Annotations for 1637017_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720