FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637018_at:

>probe:Drosophila_2:1637018_at:690:621; Interrogation_Position=162; Antisense; TGCTGGGCTTCAAGTCGCGCAAGGA
>probe:Drosophila_2:1637018_at:348:607; Interrogation_Position=192; Antisense; TGATGATCGCCACCCAGGAGGAGAT
>probe:Drosophila_2:1637018_at:283:431; Interrogation_Position=218; Antisense; GAGTCCGCCAAGCTGCCGCTGGAAT
>probe:Drosophila_2:1637018_at:622:399; Interrogation_Position=293; Antisense; GACACCTTCCCGTTTGTGTACAAGT
>probe:Drosophila_2:1637018_at:602:729; Interrogation_Position=306; Antisense; TTGTGTACAAGTGCGCCCACCAGAA
>probe:Drosophila_2:1637018_at:346:109; Interrogation_Position=327; Antisense; AGAAGCACGAGTACCTCACCTGCGA
>probe:Drosophila_2:1637018_at:298:647; Interrogation_Position=342; Antisense; TCACCTGCGAGTACGAGGACTACGT
>probe:Drosophila_2:1637018_at:274:75; Interrogation_Position=357; Antisense; AGGACTACGTGCTCCGCATGAAGGA
>probe:Drosophila_2:1637018_at:425:227; Interrogation_Position=428; Antisense; AAGGCCGCCTAGACTTAGGCTAGAT
>probe:Drosophila_2:1637018_at:379:119; Interrogation_Position=47; Antisense; AGCTGCGGCGCAACCGAAATCTAAG
>probe:Drosophila_2:1637018_at:211:145; Interrogation_Position=522; Antisense; ACTGCCCCATGTTGCAAGCTAGTTT
>probe:Drosophila_2:1637018_at:365:469; Interrogation_Position=532; Antisense; GTTGCAAGCTAGTTTCCAGCGGAAA
>probe:Drosophila_2:1637018_at:714:697; Interrogation_Position=80; Antisense; TTTACGATGGGCAACGCGCTGACGC
>probe:Drosophila_2:1637018_at:372:323; Interrogation_Position=95; Antisense; GCGCTGACGCACTACATGAAACCGG

Paste this into a BLAST search page for me
TGCTGGGCTTCAAGTCGCGCAAGGATGATGATCGCCACCCAGGAGGAGATGAGTCCGCCAAGCTGCCGCTGGAATGACACCTTCCCGTTTGTGTACAAGTTTGTGTACAAGTGCGCCCACCAGAAAGAAGCACGAGTACCTCACCTGCGATCACCTGCGAGTACGAGGACTACGTAGGACTACGTGCTCCGCATGAAGGAAAGGCCGCCTAGACTTAGGCTAGATAGCTGCGGCGCAACCGAAATCTAAGACTGCCCCATGTTGCAAGCTAGTTTGTTGCAAGCTAGTTTCCAGCGGAAATTTACGATGGGCAACGCGCTGACGCGCGCTGACGCACTACATGAAACCGG

Full Affymetrix probeset data:

Annotations for 1637018_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720