FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637022_at:

>probe:Drosophila_2:1637022_at:440:187; Interrogation_Position=2918; Antisense; AACAGGCTTGGATGGCCACGCTGGA
>probe:Drosophila_2:1637022_at:280:215; Interrogation_Position=2976; Antisense; AAGATATCTACTGCCTCGAGACGTT
>probe:Drosophila_2:1637022_at:431:611; Interrogation_Position=3020; Antisense; TGACGAGCTGCTCAACACATCAATG
>probe:Drosophila_2:1637022_at:350:659; Interrogation_Position=3052; Antisense; TAACCAGCGATACCGTGACTACCAT
>probe:Drosophila_2:1637022_at:299:673; Interrogation_Position=3071; Antisense; TACCATCTCTAATTTCGGACGCAGC
>probe:Drosophila_2:1637022_at:630:423; Interrogation_Position=3139; Antisense; GAGACTTTTCCGTCCAAAGTGCCCA
>probe:Drosophila_2:1637022_at:143:209; Interrogation_Position=3188; Antisense; AAGCATCCAGGAAAGTCGTGTCAAG
>probe:Drosophila_2:1637022_at:488:405; Interrogation_Position=3218; Antisense; GACTGCCCTGTTGGCCGAAAACGAA
>probe:Drosophila_2:1637022_at:615:337; Interrogation_Position=3278; Antisense; GCTCAAGGAAGAATTGCGCCGCCAA
>probe:Drosophila_2:1637022_at:471:613; Interrogation_Position=3320; Antisense; TGAACAACACATGCACAACTCCGAG
>probe:Drosophila_2:1637022_at:29:187; Interrogation_Position=3381; Antisense; AACAATGTCGATGAGCGGCAGCGCT
>probe:Drosophila_2:1637022_at:17:3; Interrogation_Position=3403; Antisense; GCTTGGTTCCCGTGCTAAATACCAT
>probe:Drosophila_2:1637022_at:334:7; Interrogation_Position=3426; Antisense; ATTCTCCGCCTGAGTCGCAACGAAA
>probe:Drosophila_2:1637022_at:518:51; Interrogation_Position=3456; Antisense; ATGCTGAACTGTGTGGCCAAGGGAC

Paste this into a BLAST search page for me
AACAGGCTTGGATGGCCACGCTGGAAAGATATCTACTGCCTCGAGACGTTTGACGAGCTGCTCAACACATCAATGTAACCAGCGATACCGTGACTACCATTACCATCTCTAATTTCGGACGCAGCGAGACTTTTCCGTCCAAAGTGCCCAAAGCATCCAGGAAAGTCGTGTCAAGGACTGCCCTGTTGGCCGAAAACGAAGCTCAAGGAAGAATTGCGCCGCCAATGAACAACACATGCACAACTCCGAGAACAATGTCGATGAGCGGCAGCGCTGCTTGGTTCCCGTGCTAAATACCATATTCTCCGCCTGAGTCGCAACGAAAATGCTGAACTGTGTGGCCAAGGGAC

Full Affymetrix probeset data:

Annotations for 1637022_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720