FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637023_at:

>probe:Drosophila_2:1637023_at:2:523; Interrogation_Position=118; Antisense; GGGCTGATGCTTTTGATCCAGGAAG
>probe:Drosophila_2:1637023_at:525:447; Interrogation_Position=132; Antisense; GATCCAGGAAGTTCTGGTCCTTCAA
>probe:Drosophila_2:1637023_at:184:711; Interrogation_Position=152; Antisense; TTCAATTTCTATTCCTCTGCATGGT
>probe:Drosophila_2:1637023_at:109:285; Interrogation_Position=168; Antisense; CTGCATGGTCATCCGGTGGGTATAC
>probe:Drosophila_2:1637023_at:193:169; Interrogation_Position=207; Antisense; AAATGGTATCGCTTCATCGCTGAGG
>probe:Drosophila_2:1637023_at:416:45; Interrogation_Position=222; Antisense; ATCGCTGAGGTTTCGCACACGGAAA
>probe:Drosophila_2:1637023_at:116:415; Interrogation_Position=264; Antisense; GACCATCTGGATCGTATTGCTCAAC
>probe:Drosophila_2:1637023_at:37:687; Interrogation_Position=298; Antisense; TATACGTGGAGCATCCCATGCCAGG
>probe:Drosophila_2:1637023_at:113:229; Interrogation_Position=31; Antisense; AATGGACTTGTGTTCTACCGACTGA
>probe:Drosophila_2:1637023_at:556:345; Interrogation_Position=323; Antisense; GCATCATGCAACTCAGCCGACTATT
>probe:Drosophila_2:1637023_at:502:687; Interrogation_Position=344; Antisense; TATTCCGGATATGCGCCTATAGTCG
>probe:Drosophila_2:1637023_at:334:657; Interrogation_Position=361; Antisense; TATAGTCGCACCTGGATCATGATAC
>probe:Drosophila_2:1637023_at:130:419; Interrogation_Position=60; Antisense; GAGCTTTCCGCTAAGAATTGCACTG
>probe:Drosophila_2:1637023_at:137:51; Interrogation_Position=86; Antisense; ATGCGGTGTACGTTTACCTGGAGAA

Paste this into a BLAST search page for me
GGGCTGATGCTTTTGATCCAGGAAGGATCCAGGAAGTTCTGGTCCTTCAATTCAATTTCTATTCCTCTGCATGGTCTGCATGGTCATCCGGTGGGTATACAAATGGTATCGCTTCATCGCTGAGGATCGCTGAGGTTTCGCACACGGAAAGACCATCTGGATCGTATTGCTCAACTATACGTGGAGCATCCCATGCCAGGAATGGACTTGTGTTCTACCGACTGAGCATCATGCAACTCAGCCGACTATTTATTCCGGATATGCGCCTATAGTCGTATAGTCGCACCTGGATCATGATACGAGCTTTCCGCTAAGAATTGCACTGATGCGGTGTACGTTTACCTGGAGAA

Full Affymetrix probeset data:

Annotations for 1637023_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720