FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637024_at:

>probe:Drosophila_2:1637024_at:319:93; Interrogation_Position=1036; Antisense; AGTTGGCAGTTGGTTTTCACGCCTC
>probe:Drosophila_2:1637024_at:360:129; Interrogation_Position=1075; Antisense; ACCAGCATCACTCAATCGACTGTGG
>probe:Drosophila_2:1637024_at:272:243; Interrogation_Position=1087; Antisense; CAATCGACTGTGGAGTGTGCACGGT
>probe:Drosophila_2:1637024_at:643:601; Interrogation_Position=1199; Antisense; TGTTATGTTTGTTTCTACGCTGGCT
>probe:Drosophila_2:1637024_at:108:673; Interrogation_Position=1214; Antisense; TACGCTGGCTCTTCAAAGGCTAATT
>probe:Drosophila_2:1637024_at:670:709; Interrogation_Position=1284; Antisense; TTCAAGCTACTGTTTGAGGCAGCAG
>probe:Drosophila_2:1637024_at:142:487; Interrogation_Position=1311; Antisense; GTAGATGGTTGCACAGTCGCATTAT
>probe:Drosophila_2:1637024_at:311:313; Interrogation_Position=822; Antisense; GCCACTCCATTATCATCACGAAGAA
>probe:Drosophila_2:1637024_at:599:375; Interrogation_Position=841; Antisense; GAAGAACAACACACATCAGAGCATT
>probe:Drosophila_2:1637024_at:607:351; Interrogation_Position=879; Antisense; GCAGACACGCACGACATCAGTGTTT
>probe:Drosophila_2:1637024_at:176:671; Interrogation_Position=922; Antisense; TACGACTCGCTATACGCAGTTACTG
>probe:Drosophila_2:1637024_at:594:705; Interrogation_Position=941; Antisense; TTACTGCTTGCAGGAGACGCCCGAC
>probe:Drosophila_2:1637024_at:73:379; Interrogation_Position=956; Antisense; GACGCCCGACAAACCGAAATCCGAT
>probe:Drosophila_2:1637024_at:501:393; Interrogation_Position=971; Antisense; GAAATCCGATCAGCCGTAACGCTTT

Paste this into a BLAST search page for me
AGTTGGCAGTTGGTTTTCACGCCTCACCAGCATCACTCAATCGACTGTGGCAATCGACTGTGGAGTGTGCACGGTTGTTATGTTTGTTTCTACGCTGGCTTACGCTGGCTCTTCAAAGGCTAATTTTCAAGCTACTGTTTGAGGCAGCAGGTAGATGGTTGCACAGTCGCATTATGCCACTCCATTATCATCACGAAGAAGAAGAACAACACACATCAGAGCATTGCAGACACGCACGACATCAGTGTTTTACGACTCGCTATACGCAGTTACTGTTACTGCTTGCAGGAGACGCCCGACGACGCCCGACAAACCGAAATCCGATGAAATCCGATCAGCCGTAACGCTTT

Full Affymetrix probeset data:

Annotations for 1637024_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720