Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637027_s_at:

>probe:Drosophila_2:1637027_s_at:145:501; Interrogation_Position=512; Antisense; GTCGCATTCGAAAGTGAACCCGCTC
>probe:Drosophila_2:1637027_s_at:105:467; Interrogation_Position=541; Antisense; GTTGGCTGTCGCACCGAAACAAGTC
>probe:Drosophila_2:1637027_s_at:590:47; Interrogation_Position=579; Antisense; ATCCTGCAGATTGTGGGTGGCTCCA
>probe:Drosophila_2:1637027_s_at:161:541; Interrogation_Position=717; Antisense; GGTTTTGTCAACTATTTCCAGCCCA
>probe:Drosophila_2:1637027_s_at:127:215; Interrogation_Position=741; Antisense; AAGTTCGCCCTGAAAGTAATGCCTC
>probe:Drosophila_2:1637027_s_at:703:217; Interrogation_Position=754; Antisense; AAGTAATGCCTCCATCAGAGCTTCG
>probe:Drosophila_2:1637027_s_at:522:717; Interrogation_Position=775; Antisense; TTCGCTTCCGCCATAATCTATTTGG
>probe:Drosophila_2:1637027_s_at:11:465; Interrogation_Position=799; Antisense; GATTGGTCACCTTTAGTCTGGGAAT
>probe:Drosophila_2:1637027_s_at:600:563; Interrogation_Position=819; Antisense; GGAATGGGCGCCATTTACCTGGGCT
>probe:Drosophila_2:1637027_s_at:354:673; Interrogation_Position=834; Antisense; TACCTGGGCTACTATTCGAAATTCT
>probe:Drosophila_2:1637027_s_at:291:29; Interrogation_Position=874; Antisense; ATACTGACTTTATTCCCGGCATGAT
>probe:Drosophila_2:1637027_s_at:309:131; Interrogation_Position=906; Antisense; ACCGGCATTGTTTATGGACTCACCA
>probe:Drosophila_2:1637027_s_at:621:289; Interrogation_Position=940; Antisense; CGGTGTCATCGCTTCTAACTAAACT
>probe:Drosophila_2:1637027_s_at:482:289; Interrogation_Position=988; Antisense; CGGAGCAGGCCCAGTAGGTGATACT

Paste this into a BLAST search page for me
GTCGCATTCGAAAGTGAACCCGCTCGTTGGCTGTCGCACCGAAACAAGTCATCCTGCAGATTGTGGGTGGCTCCAGGTTTTGTCAACTATTTCCAGCCCAAAGTTCGCCCTGAAAGTAATGCCTCAAGTAATGCCTCCATCAGAGCTTCGTTCGCTTCCGCCATAATCTATTTGGGATTGGTCACCTTTAGTCTGGGAATGGAATGGGCGCCATTTACCTGGGCTTACCTGGGCTACTATTCGAAATTCTATACTGACTTTATTCCCGGCATGATACCGGCATTGTTTATGGACTCACCACGGTGTCATCGCTTCTAACTAAACTCGGAGCAGGCCCAGTAGGTGATACT

Full Affymetrix probeset data:

Annotations for 1637027_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime